Incidental Mutation 'R7080:Olfr975'
ID549467
Institutional Source Beutler Lab
Gene Symbol Olfr975
Ensembl Gene ENSMUSG00000043331
Gene Nameolfactory receptor 975
SynonymsMOR224-2, GA_x6K02T2PVTD-33651220-33650288
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7080 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39948131-39952046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39950148 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 208 (C208R)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000213246] [ENSMUST00000216647] [ENSMUST00000217630]
Predicted Effect probably damaging
Transcript: ENSMUST00000054067
AA Change: C208R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: C208R

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000213246
Predicted Effect probably damaging
Transcript: ENSMUST00000216647
AA Change: C208R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,446,104 E2162G probably benign Het
Ackr4 A G 9: 104,099,562 V62A probably damaging Het
Atox1 T A 11: 55,450,539 K57* probably null Het
Atp6v1e1 G A 6: 120,822,389 probably benign Het
B020031M17Rik T C 13: 119,949,734 D112G probably benign Het
Bmpr2 T C 1: 59,867,683 V645A probably benign Het
Brwd1 T C 16: 96,009,530 T1602A probably benign Het
Cdc42bpg T C 19: 6,315,189 V692A probably damaging Het
Cdca2 T C 14: 67,698,102 D388G probably damaging Het
Celsr1 G A 15: 85,932,451 R1764C possibly damaging Het
Copz2 G T 11: 96,856,712 V174L probably benign Het
Dnaaf1 T C 8: 119,582,596 L141P probably damaging Het
Fam170a T A 18: 50,280,673 probably null Het
Fshr A T 17: 89,097,111 probably null Het
Gbx1 C T 5: 24,526,300 A173T probably benign Het
Gm3604 G A 13: 62,370,295 A83V probably damaging Het
Gpr19 A T 6: 134,870,456 V88D probably damaging Het
Hnrnpd C T 5: 99,976,533 probably null Het
Homez T C 14: 54,857,655 S199G probably benign Het
Kit T C 5: 75,607,281 I108T probably damaging Het
Lrrc34 A C 3: 30,634,556 Y199D probably damaging Het
Mapk12 T C 15: 89,133,147 D208G probably damaging Het
Mon1a A G 9: 107,901,786 D403G probably damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Nol11 G A 11: 107,180,052 T307I probably damaging Het
Olfr1066 A T 2: 86,455,491 L260* probably null Het
Olfr1107 A G 2: 87,071,739 Y132H probably damaging Het
Olfr215 A T 6: 116,582,353 F198I probably damaging Het
Olfr547 A T 7: 102,534,965 I73F possibly damaging Het
Pcdhb16 C T 18: 37,478,463 Q159* probably null Het
Phf19 G A 2: 34,898,712 probably null Het
Qrfpr C T 3: 36,180,049 R381H probably benign Het
Rad51ap2 A G 12: 11,456,365 D96G probably benign Het
Ranbp1 T C 16: 18,245,233 D93G possibly damaging Het
Reep1 A G 6: 71,780,765 D116G possibly damaging Het
Rinl T C 7: 28,796,676 C361R probably damaging Het
Rps6kb1 T C 11: 86,506,840 D393G probably damaging Het
Slc2a12 T C 10: 22,665,317 V357A probably benign Het
Spryd3 T C 15: 102,118,192 D348G probably benign Het
Syne2 G A 12: 76,052,727 A569T probably benign Het
Thoc6 C T 17: 23,673,529 R6Q probably null Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Unc13b C T 4: 43,171,926 T918I unknown Het
Unc80 A T 1: 66,646,521 H2268L possibly damaging Het
Urod C T 4: 116,992,641 A187T probably damaging Het
Usp46 G T 5: 74,016,683 N205K probably benign Het
Wapl T C 14: 34,692,356 F392L probably benign Het
Zim1 T C 7: 6,677,306 T453A possibly damaging Het
Other mutations in Olfr975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Olfr975 APN 9 39949988 missense probably benign 0.01
IGL01537:Olfr975 APN 9 39950625 missense probably benign 0.00
IGL01963:Olfr975 APN 9 39950240 missense probably damaging 1.00
IGL02400:Olfr975 APN 9 39950339 missense probably benign
IGL03115:Olfr975 APN 9 39950744 missense probably damaging 0.98
IGL03226:Olfr975 APN 9 39950423 unclassified probably null
R0088:Olfr975 UTSW 9 39950375 missense probably benign 0.03
R0212:Olfr975 UTSW 9 39949940 missense probably benign 0.44
R1668:Olfr975 UTSW 9 39950169 missense possibly damaging 0.94
R1878:Olfr975 UTSW 9 39950757 missense probably benign 0.35
R2225:Olfr975 UTSW 9 39950537 missense possibly damaging 0.84
R2291:Olfr975 UTSW 9 39950334 missense probably benign 0.19
R2420:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2421:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2422:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2425:Olfr975 UTSW 9 39949841 missense probably null 0.25
R2918:Olfr975 UTSW 9 39950364 missense probably benign
R4536:Olfr975 UTSW 9 39950435 missense probably damaging 1.00
R4709:Olfr975 UTSW 9 39949869 missense probably damaging 0.97
R4831:Olfr975 UTSW 9 39950112 missense probably benign 0.01
R4921:Olfr975 UTSW 9 39950225 missense probably damaging 0.98
R5113:Olfr975 UTSW 9 39949925 missense probably damaging 0.99
R5141:Olfr975 UTSW 9 39949874 missense probably benign 0.07
R5195:Olfr975 UTSW 9 39950679 missense probably benign
R5213:Olfr975 UTSW 9 39950093 missense probably damaging 0.99
R5568:Olfr975 UTSW 9 39950687 missense probably benign 0.05
R6993:Olfr975 UTSW 9 39950637 missense probably benign
R7436:Olfr975 UTSW 9 39950053 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGAATCCAGCCAAGGACTG -3'
(R):5'- TCACCCTTTGAGGTACACAGTC -3'

Sequencing Primer
(F):5'- GGACTGGAGGCAGGTCTG -3'
(R):5'- CACAGTCATAATGAGTTCATGGGTG -3'
Posted On2019-05-15