Incidental Mutation 'R7080:Slc2a12'
ID549470
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7080 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22665317 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 357 (V357A)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
AA Change: V357A

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: V357A

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,446,104 E2162G probably benign Het
Ackr4 A G 9: 104,099,562 V62A probably damaging Het
Atox1 T A 11: 55,450,539 K57* probably null Het
Atp6v1e1 G A 6: 120,822,389 probably benign Het
B020031M17Rik T C 13: 119,949,734 D112G probably benign Het
Bmpr2 T C 1: 59,867,683 V645A probably benign Het
Brwd1 T C 16: 96,009,530 T1602A probably benign Het
Cdc42bpg T C 19: 6,315,189 V692A probably damaging Het
Cdca2 T C 14: 67,698,102 D388G probably damaging Het
Celsr1 G A 15: 85,932,451 R1764C possibly damaging Het
Copz2 G T 11: 96,856,712 V174L probably benign Het
Dnaaf1 T C 8: 119,582,596 L141P probably damaging Het
Fam170a T A 18: 50,280,673 probably null Het
Fshr A T 17: 89,097,111 probably null Het
Gbx1 C T 5: 24,526,300 A173T probably benign Het
Gm3604 G A 13: 62,370,295 A83V probably damaging Het
Gpr19 A T 6: 134,870,456 V88D probably damaging Het
Hnrnpd C T 5: 99,976,533 probably null Het
Homez T C 14: 54,857,655 S199G probably benign Het
Kit T C 5: 75,607,281 I108T probably damaging Het
Lrrc34 A C 3: 30,634,556 Y199D probably damaging Het
Mapk12 T C 15: 89,133,147 D208G probably damaging Het
Mon1a A G 9: 107,901,786 D403G probably damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Nol11 G A 11: 107,180,052 T307I probably damaging Het
Olfr1066 A T 2: 86,455,491 L260* probably null Het
Olfr1107 A G 2: 87,071,739 Y132H probably damaging Het
Olfr215 A T 6: 116,582,353 F198I probably damaging Het
Olfr547 A T 7: 102,534,965 I73F possibly damaging Het
Olfr975 A G 9: 39,950,148 C208R probably damaging Het
Pcdhb16 C T 18: 37,478,463 Q159* probably null Het
Phf19 G A 2: 34,898,712 probably null Het
Qrfpr C T 3: 36,180,049 R381H probably benign Het
Rad51ap2 A G 12: 11,456,365 D96G probably benign Het
Ranbp1 T C 16: 18,245,233 D93G possibly damaging Het
Reep1 A G 6: 71,780,765 D116G possibly damaging Het
Rinl T C 7: 28,796,676 C361R probably damaging Het
Rps6kb1 T C 11: 86,506,840 D393G probably damaging Het
Spryd3 T C 15: 102,118,192 D348G probably benign Het
Syne2 G A 12: 76,052,727 A569T probably benign Het
Thoc6 C T 17: 23,673,529 R6Q probably null Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Unc13b C T 4: 43,171,926 T918I unknown Het
Unc80 A T 1: 66,646,521 H2268L possibly damaging Het
Urod C T 4: 116,992,641 A187T probably damaging Het
Usp46 G T 5: 74,016,683 N205K probably benign Het
Wapl T C 14: 34,692,356 F392L probably benign Het
Zim1 T C 7: 6,677,306 T453A possibly damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCTAAGGACAACATGAGGACC -3'
(R):5'- TAAAGTGCTCCCTGAGACTGC -3'

Sequencing Primer
(F):5'- CAGAATCCTGATAGGTCTGACACTG -3'
(R):5'- AAAGTGCTCCCTGAGACTGCTATTG -3'
Posted On2019-05-15