Incidental Mutation 'R7082:Speg'
ID549570
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7082 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75411447 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1483 (T1483I)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
Predicted Effect probably damaging
Transcript: ENSMUST00000087122
AA Change: T1483I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T1483I

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,280 N109Y unknown Het
A430005L14Rik C T 4: 153,959,764 R11W probably damaging Het
Aadacl2 T A 3: 60,024,885 S274T probably damaging Het
Ahctf1 T C 1: 179,775,333 R887G probably benign Het
Aox4 G T 1: 58,224,193 R158L possibly damaging Het
Atp10a T C 7: 58,658,819 I122T probably damaging Het
Batf2 G T 19: 6,171,375 A72S possibly damaging Het
Bptf T C 11: 107,086,747 D749G probably benign Het
Cacybp A G 1: 160,203,659 Y200H probably damaging Het
Cdc40 A T 10: 40,867,873 V76D probably benign Het
Cdc42ep4 T C 11: 113,729,118 D149G probably benign Het
Chtop A G 3: 90,507,584 V9A probably benign Het
Cnot9 A G 1: 74,527,006 I185M probably damaging Het
Col6a5 A G 9: 105,931,239 I870T unknown Het
Cr1l A G 1: 195,123,698 I159T probably benign Het
Cthrc1 T C 15: 39,077,100 S33P probably benign Het
Dlg2 T A 7: 90,731,984 W44R probably benign Het
Dlgap4 T C 2: 156,748,422 probably null Het
Dna2 A G 10: 62,954,317 H193R possibly damaging Het
Espnl T A 1: 91,334,799 F322Y probably benign Het
Fam171a1 G A 2: 3,223,475 V293I probably benign Het
Fam76b A G 9: 13,833,012 Y135C probably damaging Het
Flvcr2 A T 12: 85,746,954 I35F probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm14548 C T 7: 3,895,511 V313M probably damaging Het
Gm9195 T A 14: 72,442,712 Q2219L probably benign Het
Gm9573 A T 17: 35,621,201 S698T unknown Het
Gnptg T C 17: 25,234,720 T283A probably benign Het
Grap2 G A 15: 80,648,498 V289M probably benign Het
Hk3 T C 13: 55,006,897 T767A probably benign Het
Hs3st5 A G 10: 36,832,837 I123V probably benign Het
Il6st A G 13: 112,504,032 T781A probably damaging Het
Inpp5d T A 1: 87,695,380 H398Q probably damaging Het
Kcnk1 A G 8: 125,995,548 Y30C probably damaging Het
Klhl6 T C 16: 19,982,883 T41A probably benign Het
Krt14 G A 11: 100,203,341 H476Y possibly damaging Het
Lingo3 G C 10: 80,835,791 R102G probably benign Het
Map3k9 G A 12: 81,724,702 T704M probably damaging Het
Mdn1 C A 4: 32,762,341 N5088K probably benign Het
Mmp9 T A 2: 164,948,892 S67T probably benign Het
Mrps18c A G 5: 100,804,404 E143G probably damaging Het
Nags C A 11: 102,147,472 R335S possibly damaging Het
Nars A G 18: 64,504,354 V385A possibly damaging Het
Nipal2 A C 15: 34,584,663 V253G possibly damaging Het
Nos2 C A 11: 78,928,579 T39K probably benign Het
Olfr1411 G A 1: 92,596,418 probably benign Het
Olfr574 T C 7: 102,949,248 V261A probably damaging Het
Olfr601 C A 7: 103,358,288 R302L possibly damaging Het
Olfr796 T A 10: 129,607,547 *311Y probably null Het
Olfr796 T A 10: 129,607,548 *311L probably null Het
Olfr798 C T 10: 129,625,765 V99M probably benign Het
Panx3 G A 9: 37,666,617 P106S probably benign Het
Pappa2 G A 1: 158,763,119 T1655I possibly damaging Het
Pcdhb1 A G 18: 37,266,991 D665G probably damaging Het
Pde2a T C 7: 101,508,096 L676P probably damaging Het
Pf4 A G 5: 90,772,992 T60A possibly damaging Het
Pld5 A T 1: 176,089,876 C164S probably benign Het
Psd3 A T 8: 67,904,148 M640K probably benign Het
Ptf1a A G 2: 19,445,865 D2G possibly damaging Het
Ptprq C T 10: 107,708,730 C313Y probably benign Het
Ranbp10 A G 8: 105,773,946 S467P probably damaging Het
Rap1gap C T 4: 137,718,936 T333M probably damaging Het
Rfpl4 A G 7: 5,115,559 L4P probably benign Het
Rgs12 A G 5: 34,966,706 N611S probably benign Het
Sacs C A 14: 61,210,517 N3337K possibly damaging Het
Sbno2 A T 10: 80,060,090 probably null Het
Scrn2 T A 11: 97,033,082 V264E possibly damaging Het
Serpinb9c T A 13: 33,154,407 I198L probably benign Het
Shank2 T C 7: 144,410,359 F568S probably damaging Het
Slc47a1 C T 11: 61,377,941 R36Q probably benign Het
Slc4a8 A C 15: 100,791,027 E406A probably damaging Het
Srbd1 A G 17: 86,057,732 V632A probably damaging Het
Srd5a2 A T 17: 74,021,520 Y188N probably damaging Het
Sspo A T 6: 48,478,609 probably null Het
Ssx2ip A T 3: 146,430,948 D317V probably benign Het
Tmco3 G T 8: 13,320,847 E172* probably null Het
Trpc4 G A 3: 54,299,098 W573* probably null Het
Ttn T C 2: 76,749,996 I23518V probably benign Het
Tubal3 A G 13: 3,933,050 T277A possibly damaging Het
Uhrf1bp1 G T 17: 27,890,065 R1086L probably damaging Het
Unc5b A T 10: 60,775,088 L391H probably damaging Het
Vmn2r76 A G 7: 86,225,232 F846L probably benign Het
Vps13c T A 9: 67,883,453 Y338N probably damaging Het
Zc3hav1 G T 6: 38,332,393 S498* probably null Het
Zfand4 T A 6: 116,328,376 probably null Het
Zfp451 A T 1: 33,772,891 probably null Het
Zfp607a A T 7: 27,878,758 I418F probably damaging Het
Zfp612 A G 8: 110,089,705 T515A probably damaging Het
Zfp708 G T 13: 67,071,136 L208I possibly damaging Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5371:Speg UTSW 1 75431393 missense possibly damaging 0.50
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TATCTTCCTTAGCTGCCGGG -3'
(R):5'- GACCTTGTGCTGGAATGTAAC -3'

Sequencing Primer
(F):5'- TTAGCTGCCGGGGAGCC -3'
(R):5'- TACTCTACAGTAACCTGGGCAGTG -3'
Posted On2019-05-15