Incidental Mutation 'R0614:Myo15b'
ID54962
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115882913 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 270 (P270T)
Ref Sequence ENSEMBL: ENSMUSP00000048072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably damaging
Transcript: ENSMUST00000040703
AA Change: P270T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427
AA Change: P270T

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093911
AA Change: P1924T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: P1924T

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151507
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222123
AA Change: P502T

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0276 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
R6963:Myo15b UTSW 11 115890714 splice site probably null
R7015:Myo15b UTSW 11 115871844 missense
R7020:Myo15b UTSW 11 115866667 nonsense probably null
R7096:Myo15b UTSW 11 115891498 splice site probably null
R7219:Myo15b UTSW 11 115877095 critical splice donor site probably null
R7400:Myo15b UTSW 11 115860113 missense
R7413:Myo15b UTSW 11 115878144 missense
R7483:Myo15b UTSW 11 115858744 missense
R7523:Myo15b UTSW 11 115890858 missense not run
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGCGATGATTCTGGTAAGAAC -3'
(R):5'- TCATCTTGATAGGTCCGGCAGCTAC -3'

Sequencing Primer
(F):5'- acaaacaaacaaacaaacaaacaaac -3'
(R):5'- AGCTACCTGTCACCCATCG -3'
Posted On2013-07-11