Incidental Mutation 'R7082:Pcdhb1'
ID549652
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Nameprotocadherin beta 1
SynonymsPcdhbA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7082 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37264938-37267525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37266991 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 665 (D665G)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: D665G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: D665G

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,280 N109Y unknown Het
A430005L14Rik C T 4: 153,959,764 R11W probably damaging Het
Aadacl2 T A 3: 60,024,885 S274T probably damaging Het
Ahctf1 T C 1: 179,775,333 R887G probably benign Het
Aox4 G T 1: 58,224,193 R158L possibly damaging Het
Atp10a T C 7: 58,658,819 I122T probably damaging Het
Batf2 G T 19: 6,171,375 A72S possibly damaging Het
Bptf T C 11: 107,086,747 D749G probably benign Het
Cacybp A G 1: 160,203,659 Y200H probably damaging Het
Cdc40 A T 10: 40,867,873 V76D probably benign Het
Cdc42ep4 T C 11: 113,729,118 D149G probably benign Het
Chtop A G 3: 90,507,584 V9A probably benign Het
Cnot9 A G 1: 74,527,006 I185M probably damaging Het
Col6a5 A G 9: 105,931,239 I870T unknown Het
Cr1l A G 1: 195,123,698 I159T probably benign Het
Cthrc1 T C 15: 39,077,100 S33P probably benign Het
Dlg2 T A 7: 90,731,984 W44R probably benign Het
Dlgap4 T C 2: 156,748,422 probably null Het
Dna2 A G 10: 62,954,317 H193R possibly damaging Het
Espnl T A 1: 91,334,799 F322Y probably benign Het
Fam171a1 G A 2: 3,223,475 V293I probably benign Het
Fam76b A G 9: 13,833,012 Y135C probably damaging Het
Flvcr2 A T 12: 85,746,954 I35F probably benign Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Gm14548 C T 7: 3,895,511 V313M probably damaging Het
Gm9195 T A 14: 72,442,712 Q2219L probably benign Het
Gm9573 A T 17: 35,621,201 S698T unknown Het
Gnptg T C 17: 25,234,720 T283A probably benign Het
Grap2 G A 15: 80,648,498 V289M probably benign Het
Hk3 T C 13: 55,006,897 T767A probably benign Het
Hs3st5 A G 10: 36,832,837 I123V probably benign Het
Il6st A G 13: 112,504,032 T781A probably damaging Het
Inpp5d T A 1: 87,695,380 H398Q probably damaging Het
Kcnk1 A G 8: 125,995,548 Y30C probably damaging Het
Klhl6 T C 16: 19,982,883 T41A probably benign Het
Krt14 G A 11: 100,203,341 H476Y possibly damaging Het
Lingo3 G C 10: 80,835,791 R102G probably benign Het
Map3k9 G A 12: 81,724,702 T704M probably damaging Het
Mdn1 C A 4: 32,762,341 N5088K probably benign Het
Mmp9 T A 2: 164,948,892 S67T probably benign Het
Mrps18c A G 5: 100,804,404 E143G probably damaging Het
Nags C A 11: 102,147,472 R335S possibly damaging Het
Nars A G 18: 64,504,354 V385A possibly damaging Het
Nipal2 A C 15: 34,584,663 V253G possibly damaging Het
Nos2 C A 11: 78,928,579 T39K probably benign Het
Olfr1411 G A 1: 92,596,418 probably benign Het
Olfr574 T C 7: 102,949,248 V261A probably damaging Het
Olfr601 C A 7: 103,358,288 R302L possibly damaging Het
Olfr796 T A 10: 129,607,547 *311Y probably null Het
Olfr796 T A 10: 129,607,548 *311L probably null Het
Olfr798 C T 10: 129,625,765 V99M probably benign Het
Panx3 G A 9: 37,666,617 P106S probably benign Het
Pappa2 G A 1: 158,763,119 T1655I possibly damaging Het
Pde2a T C 7: 101,508,096 L676P probably damaging Het
Pf4 A G 5: 90,772,992 T60A possibly damaging Het
Pld5 A T 1: 176,089,876 C164S probably benign Het
Psd3 A T 8: 67,904,148 M640K probably benign Het
Ptf1a A G 2: 19,445,865 D2G possibly damaging Het
Ptprq C T 10: 107,708,730 C313Y probably benign Het
Ranbp10 A G 8: 105,773,946 S467P probably damaging Het
Rap1gap C T 4: 137,718,936 T333M probably damaging Het
Rfpl4 A G 7: 5,115,559 L4P probably benign Het
Rgs12 A G 5: 34,966,706 N611S probably benign Het
Sacs C A 14: 61,210,517 N3337K possibly damaging Het
Sbno2 A T 10: 80,060,090 probably null Het
Scrn2 T A 11: 97,033,082 V264E possibly damaging Het
Serpinb9c T A 13: 33,154,407 I198L probably benign Het
Shank2 T C 7: 144,410,359 F568S probably damaging Het
Slc47a1 C T 11: 61,377,941 R36Q probably benign Het
Slc4a8 A C 15: 100,791,027 E406A probably damaging Het
Speg C T 1: 75,411,447 T1483I probably damaging Het
Srbd1 A G 17: 86,057,732 V632A probably damaging Het
Srd5a2 A T 17: 74,021,520 Y188N probably damaging Het
Sspo A T 6: 48,478,609 probably null Het
Ssx2ip A T 3: 146,430,948 D317V probably benign Het
Tmco3 G T 8: 13,320,847 E172* probably null Het
Trpc4 G A 3: 54,299,098 W573* probably null Het
Ttn T C 2: 76,749,996 I23518V probably benign Het
Tubal3 A G 13: 3,933,050 T277A possibly damaging Het
Uhrf1bp1 G T 17: 27,890,065 R1086L probably damaging Het
Unc5b A T 10: 60,775,088 L391H probably damaging Het
Vmn2r76 A G 7: 86,225,232 F846L probably benign Het
Vps13c T A 9: 67,883,453 Y338N probably damaging Het
Zc3hav1 G T 6: 38,332,393 S498* probably null Het
Zfand4 T A 6: 116,328,376 probably null Het
Zfp451 A T 1: 33,772,891 probably null Het
Zfp607a A T 7: 27,878,758 I418F probably damaging Het
Zfp612 A G 8: 110,089,705 T515A probably damaging Het
Zfp708 G T 13: 67,071,136 L208I possibly damaging Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1187:Pcdhb1 UTSW 18 37265544 missense probably damaging 1.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2897:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R2898:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4291:Pcdhb1 UTSW 18 37265417 missense probably damaging 1.00
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4332:Pcdhb1 UTSW 18 37265530 missense probably damaging 1.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAAAGCCACAGACCTTGGG -3'
(R):5'- TCCTTGAACCAAGTTGTTAGGG -3'

Sequencing Primer
(F):5'- AAGCCACAGACCTTGGGTTATTTTC -3'
(R):5'- CAGTCATCATAGAAGTGCTCTTG -3'
Posted On2019-05-15