Incidental Mutation 'R7084:Mme'
ID549730
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7084 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63328217 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 195 (Y195H)
Ref Sequence ENSEMBL: ENSMUSP00000029400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000191633] [ENSMUST00000192002] [ENSMUST00000194134] [ENSMUST00000194150] [ENSMUST00000194324] [ENSMUST00000194836]
Predicted Effect probably damaging
Transcript: ENSMUST00000029400
AA Change: Y195H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: Y195H

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191633
SMART Domains Protein: ENSMUSP00000141469
Gene: ENSMUSG00000027820

DomainStartEndE-ValueType
Pfam:Peptidase_M13_N 14 130 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192002
SMART Domains Protein: ENSMUSP00000141483
Gene: ENSMUSG00000027820

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 178 1.9e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194134
AA Change: Y195H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: Y195H

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194150
AA Change: Y195H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: Y195H

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194324
SMART Domains Protein: ENSMUSP00000142259
Gene: ENSMUSG00000027820

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-8 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 131 2.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194836
SMART Domains Protein: ENSMUSP00000141452
Gene: ENSMUSG00000027820

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 1e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 187 5.6e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,488,185 D8E unknown Het
4931440F15Rik G T 11: 29,825,009 H149Q probably damaging Het
Abca5 T A 11: 110,301,545 I714L probably benign Het
Abce1 T A 8: 79,699,414 S245C probably benign Het
Abcg1 T A 17: 31,106,131 D310E probably benign Het
Adhfe1 T A 1: 9,566,805 I394N probably benign Het
Apob A T 12: 8,009,591 D2691V probably benign Het
Arhgap18 A G 10: 26,872,738 T340A possibly damaging Het
Arsb A T 13: 93,940,616 Q497L probably benign Het
Asic5 T C 3: 82,012,011 I354T probably benign Het
Atp6v0a1 T C 11: 101,034,042 C318R probably damaging Het
Cftr T C 6: 18,226,138 Y362H probably benign Het
Crip3 T C 17: 46,430,790 Y113H probably benign Het
Dcaf4 AT A 12: 83,537,797 probably null Het
Dock10 T A 1: 80,503,856 I475F Het
Dqx1 T A 6: 83,066,455 Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 Q2437K possibly damaging Het
Ednra A T 8: 77,665,105 C385* probably null Het
Fam216a G A 5: 122,369,560 T68I probably benign Het
Fbxw22 A G 9: 109,404,223 L14P probably damaging Het
Fkbp10 A G 11: 100,421,303 I230V possibly damaging Het
Ggn C A 7: 29,172,998 A637E probably damaging Het
Gm156 C A 6: 129,766,710 A204S possibly damaging Het
Hcrtr2 T C 9: 76,230,660 D391G probably benign Het
Heatr5b A T 17: 78,810,563 V817D possibly damaging Het
Il1f10 G A 2: 24,293,670 W120* probably null Het
Irf5 C A 6: 29,535,877 R297S probably damaging Het
Jak2 A G 19: 29,286,398 T438A possibly damaging Het
Jsrp1 T C 10: 80,808,576 D332G possibly damaging Het
Kank4 A T 4: 98,771,345 V832D probably damaging Het
Kcnip3 C T 2: 127,510,936 S25N probably benign Het
Klk1b16 C T 7: 44,139,486 H48Y probably benign Het
Krtap5-4 G A 7: 142,303,872 C93Y unknown Het
Lacc1 T A 14: 77,029,656 Q389L probably benign Het
Lin9 C A 1: 180,688,096 T477K probably benign Het
Lpar2 A T 8: 69,823,606 N15I probably damaging Het
Ltbp2 C A 12: 84,868,685 C200F probably damaging Het
Mall G T 2: 127,708,873 H122Q probably benign Het
Mast3 T C 8: 70,779,473 I1287V probably benign Het
Mindy4 T C 6: 55,278,235 I566T probably benign Het
Mpzl1 T C 1: 165,604,698 T173A probably benign Het
Mri1 G T 8: 84,251,079 T209N Het
Myo1e A G 9: 70,337,801 I394V probably damaging Het
Nat14 T C 7: 4,924,330 V167A possibly damaging Het
Nfasc A G 1: 132,570,509 Y1212H unknown Het
Nsun7 T A 5: 66,295,421 L493Q probably damaging Het
Obsl1 A T 1: 75,487,750 S1637R probably benign Het
Ocstamp A T 2: 165,398,037 Y76* probably null Het
Olfr1443 A C 19: 12,680,834 H242P probably damaging Het
Olfr769 T A 10: 129,111,547 K293* probably null Het
Olfr917 G A 9: 38,665,269 R192C probably benign Het
Otog T A 7: 46,298,566 C145* probably null Het
Padi6 T A 4: 140,741,558 K5* probably null Het
Pcdha5 T A 18: 36,961,562 S375T probably benign Het
Pde10a C T 17: 8,941,162 P140S probably benign Het
Pgbd1 C G 13: 21,423,130 C298S possibly damaging Het
Plch2 C T 4: 154,986,991 G977D probably benign Het
Pou2f3 T C 9: 43,128,893 T367A probably damaging Het
Ppm1j T A 3: 104,784,960 Y352N probably damaging Het
Prkag2 T C 5: 25,021,969 T97A probably benign Het
Rpl36a-ps1 T A 14: 98,994,224 Y26F probably benign Het
Sctr A T 1: 120,063,271 N445Y possibly damaging Het
Serping1 C T 2: 84,773,491 V69I probably benign Het
Slc8a2 T A 7: 16,145,038 L483Q probably benign Het
Spag17 T C 3: 99,939,270 F37L probably benign Het
Srrm2 T A 17: 23,820,316 M1978K probably damaging Het
Tcp11 T C 17: 28,067,021 Q540R probably benign Het
Thnsl1 G T 2: 21,212,330 R298S possibly damaging Het
Tigd5 T A 15: 75,910,381 Y197* probably null Het
Tmprss11g A T 5: 86,492,200 L203Q probably damaging Het
Trim35 T A 14: 66,308,822 V346E probably damaging Het
Ttn T C 2: 76,768,364 I19402V possibly damaging Het
Ttn C T 2: 76,919,345 E3787K probably benign Het
Tut1 G A 19: 8,965,414 V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 I18V probably benign Het
Zbbx T C 3: 75,139,546 N22S possibly damaging Het
Zfp169 A C 13: 48,498,863 M26R probably benign Het
Zfp180 T A 7: 24,105,261 H368Q probably damaging Het
Zfp638 T A 6: 83,953,126 S770T possibly damaging Het
Znrf1 T C 8: 111,537,142 M1T probably null Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6842:Mme UTSW 3 63362044 missense probably damaging 1.00
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATGGGTGGCCAGTAGCATC -3'
(R):5'- AGGGCAGGGATTTCTTATACTTTAG -3'

Sequencing Primer
(F):5'- CCAGTAGCATCAGATAACTGGGATC -3'
(R):5'- TCATGCATTGAAAGGAAGAATTAGC -3'
Posted On2019-05-15