Incidental Mutation 'R7084:Otog'
ID549754
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R7084 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 46298566 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 145 (C145*)
Ref Sequence ENSEMBL: ENSMUSP00000147899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538] [ENSMUST00000209802]
Predicted Effect probably null
Transcript: ENSMUST00000164538
AA Change: C2330*
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: C2330*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209802
AA Change: C145*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,488,185 D8E unknown Het
4931440F15Rik G T 11: 29,825,009 H149Q probably damaging Het
Abca5 T A 11: 110,301,545 I714L probably benign Het
Abce1 T A 8: 79,699,414 S245C probably benign Het
Abcg1 T A 17: 31,106,131 D310E probably benign Het
Adhfe1 T A 1: 9,566,805 I394N probably benign Het
Apob A T 12: 8,009,591 D2691V probably benign Het
Arhgap18 A G 10: 26,872,738 T340A possibly damaging Het
Arsb A T 13: 93,940,616 Q497L probably benign Het
Asic5 T C 3: 82,012,011 I354T probably benign Het
Atp6v0a1 T C 11: 101,034,042 C318R probably damaging Het
Cftr T C 6: 18,226,138 Y362H probably benign Het
Crip3 T C 17: 46,430,790 Y113H probably benign Het
Dcaf4 AT A 12: 83,537,797 probably null Het
Dock10 T A 1: 80,503,856 I475F Het
Dqx1 T A 6: 83,066,455 Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 Q2437K possibly damaging Het
Ednra A T 8: 77,665,105 C385* probably null Het
Fam216a G A 5: 122,369,560 T68I probably benign Het
Fbxw22 A G 9: 109,404,223 L14P probably damaging Het
Fkbp10 A G 11: 100,421,303 I230V possibly damaging Het
Ggn C A 7: 29,172,998 A637E probably damaging Het
Gm156 C A 6: 129,766,710 A204S possibly damaging Het
Hcrtr2 T C 9: 76,230,660 D391G probably benign Het
Heatr5b A T 17: 78,810,563 V817D possibly damaging Het
Il1f10 G A 2: 24,293,670 W120* probably null Het
Irf5 C A 6: 29,535,877 R297S probably damaging Het
Jak2 A G 19: 29,286,398 T438A possibly damaging Het
Jsrp1 T C 10: 80,808,576 D332G possibly damaging Het
Kank4 A T 4: 98,771,345 V832D probably damaging Het
Kcnip3 C T 2: 127,510,936 S25N probably benign Het
Klk1b16 C T 7: 44,139,486 H48Y probably benign Het
Krtap5-4 G A 7: 142,303,872 C93Y unknown Het
Lacc1 T A 14: 77,029,656 Q389L probably benign Het
Lin9 C A 1: 180,688,096 T477K probably benign Het
Lpar2 A T 8: 69,823,606 N15I probably damaging Het
Ltbp2 C A 12: 84,868,685 C200F probably damaging Het
Mall G T 2: 127,708,873 H122Q probably benign Het
Mast3 T C 8: 70,779,473 I1287V probably benign Het
Mindy4 T C 6: 55,278,235 I566T probably benign Het
Mme T C 3: 63,328,217 Y195H probably damaging Het
Mpzl1 T C 1: 165,604,698 T173A probably benign Het
Mri1 G T 8: 84,251,079 T209N Het
Myo1e A G 9: 70,337,801 I394V probably damaging Het
Nat14 T C 7: 4,924,330 V167A possibly damaging Het
Nfasc A G 1: 132,570,509 Y1212H unknown Het
Nsun7 T A 5: 66,295,421 L493Q probably damaging Het
Obsl1 A T 1: 75,487,750 S1637R probably benign Het
Ocstamp A T 2: 165,398,037 Y76* probably null Het
Olfr1443 A C 19: 12,680,834 H242P probably damaging Het
Olfr769 T A 10: 129,111,547 K293* probably null Het
Olfr917 G A 9: 38,665,269 R192C probably benign Het
Padi6 T A 4: 140,741,558 K5* probably null Het
Pcdha5 T A 18: 36,961,562 S375T probably benign Het
Pde10a C T 17: 8,941,162 P140S probably benign Het
Pgbd1 C G 13: 21,423,130 C298S possibly damaging Het
Plch2 C T 4: 154,986,991 G977D probably benign Het
Pou2f3 T C 9: 43,128,893 T367A probably damaging Het
Ppm1j T A 3: 104,784,960 Y352N probably damaging Het
Prkag2 T C 5: 25,021,969 T97A probably benign Het
Rpl36a-ps1 T A 14: 98,994,224 Y26F probably benign Het
Sctr A T 1: 120,063,271 N445Y possibly damaging Het
Serping1 C T 2: 84,773,491 V69I probably benign Het
Slc8a2 T A 7: 16,145,038 L483Q probably benign Het
Spag17 T C 3: 99,939,270 F37L probably benign Het
Srrm2 T A 17: 23,820,316 M1978K probably damaging Het
Tcp11 T C 17: 28,067,021 Q540R probably benign Het
Thnsl1 G T 2: 21,212,330 R298S possibly damaging Het
Tigd5 T A 15: 75,910,381 Y197* probably null Het
Tmprss11g A T 5: 86,492,200 L203Q probably damaging Het
Trim35 T A 14: 66,308,822 V346E probably damaging Het
Ttn T C 2: 76,768,364 I19402V possibly damaging Het
Ttn C T 2: 76,919,345 E3787K probably benign Het
Tut1 G A 19: 8,965,414 V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 I18V probably benign Het
Zbbx T C 3: 75,139,546 N22S possibly damaging Het
Zfp169 A C 13: 48,498,863 M26R probably benign Het
Zfp180 T A 7: 24,105,261 H368Q probably damaging Het
Zfp638 T A 6: 83,953,126 S770T possibly damaging Het
Znrf1 T C 8: 111,537,142 M1T probably null Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATCCATGGAGTACAGCATGG -3'
(R):5'- ACTATGAAGCTCGGGGAAGC -3'

Sequencing Primer
(F):5'- ATGGGGCGACTTCCTGG -3'
(R):5'- AAGCGTTGACTTGACGTGGC -3'
Posted On2019-05-15