Incidental Mutation 'R7085:Tns1'
ID549799
Institutional Source Beutler Lab
Gene Symbol Tns1
Ensembl Gene ENSMUSG00000055322
Gene Nametensin 1
Synonyms1110018I21Rik, 1200014E20Rik, E030018G17Rik, E030037J05Rik, Tns
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.631) question?
Stock #R7085 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location73910231-74124449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73925462 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 81 (P81S)
Ref Sequence ENSEMBL: ENSMUSP00000139844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169786] [ENSMUST00000187584] [ENSMUST00000187691] [ENSMUST00000191104] [ENSMUST00000212888]
Predicted Effect probably benign
Transcript: ENSMUST00000169786
AA Change: P1345S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322
AA Change: P1345S

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185331
AA Change: P1162S

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000185702
AA Change: P1175S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000187584
AA Change: P1280S

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140254
Gene: ENSMUSG00000055322
AA Change: P1280S

DomainStartEndE-ValueType
C1 21 67 8.6e-5 SMART
low complexity region 113 124 N/A INTRINSIC
PTPc_DSPc 197 319 9.9e-6 SMART
PTEN_C2 306 433 5.6e-56 SMART
low complexity region 778 789 N/A INTRINSIC
low complexity region 861 878 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1219 1235 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1453 1465 N/A INTRINSIC
SH2 1549 1651 4.3e-19 SMART
PTB 1682 1823 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187691
AA Change: P81S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139844
Gene: ENSMUSG00000055322
AA Change: P81S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
SH2 350 452 4.3e-19 SMART
PTB 483 624 9e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189228
AA Change: P38S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000191104
AA Change: P1324S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322
AA Change: P1324S

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212888
AA Change: P1337S

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to focal adhesions, regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain, which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility, and develop kidney cysts and progressive kidney degeneration that may lead to death from renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,683,465 L878P possibly damaging Het
9330159F19Rik T C 10: 29,224,480 L283P probably damaging Het
Abhd18 T C 3: 40,916,909 M132T possibly damaging Het
Afap1l1 A G 18: 61,748,814 V270A possibly damaging Het
Ankrd34a A T 3: 96,598,629 Q383L probably benign Het
Atp8b5 A G 4: 43,361,835 D627G probably damaging Het
Atrnl1 T A 19: 57,691,857 C730S probably damaging Het
Bclaf1 T C 10: 20,322,022 S4P unknown Het
Blzf1 T C 1: 164,302,324 D153G probably damaging Het
Btaf1 T C 19: 36,972,918 V516A probably benign Het
C1qa T C 4: 136,897,780 T20A probably benign Het
Cacna1e A T 1: 154,473,746 probably null Het
Cfd T G 10: 79,892,492 V229G probably damaging Het
Chd3 T A 11: 69,369,201 H64L unknown Het
Cntn3 A G 6: 102,165,401 S1002P possibly damaging Het
Cntrl T A 2: 35,165,792 C1786S probably benign Het
Cpa1 A G 6: 30,643,620 D355G probably benign Het
D130043K22Rik T C 13: 24,872,302 V539A possibly damaging Het
Ddx1 A C 12: 13,229,355 W428G probably damaging Het
Ddx49 G A 8: 70,302,483 probably benign Het
Dnhd1 T A 7: 105,715,261 V4207E probably benign Het
Dock3 A G 9: 106,901,887 S288P probably damaging Het
Drap1 G A 19: 5,424,787 probably benign Het
Ecm2 G A 13: 49,520,902 R266K probably damaging Het
Emilin2 A G 17: 71,274,105 L542S probably damaging Het
Evx1 T C 6: 52,316,692 Y282H possibly damaging Het
Fam159b G T 13: 104,858,306 T111K probably benign Het
Fbxo44 T A 4: 148,158,743 H20L probably damaging Het
Flot2 G T 11: 78,058,074 A292S possibly damaging Het
Fry A G 5: 150,438,749 I2161V probably benign Het
Gli3 T C 13: 15,715,062 F587S probably damaging Het
Gm10697 T A 3: 94,072,632 M5L probably benign Het
Gm4450 T C 3: 98,450,394 N101D probably damaging Het
Gm49368 A G 7: 128,126,857 D1147G unknown Het
Gm6970 A G 19: 47,170,662 V158A unknown Het
Gprc5b A T 7: 118,983,632 M338K probably damaging Het
Hacd3 A C 9: 64,998,243 N204K probably damaging Het
Hydin A G 8: 110,603,330 T4899A probably benign Het
Ido2 T A 8: 24,558,196 R49S probably benign Het
Igsf3 C A 3: 101,455,489 T942K probably benign Het
Kank4 T A 4: 98,779,946 Q88L probably benign Het
Krtap16-1 T A 11: 99,986,285 I98F possibly damaging Het
Laptm4a T C 12: 8,922,113 V52A probably benign Het
Lmbr1 A T 5: 29,361,092 probably null Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Mafa G T 15: 75,747,687 A79E unknown Het
Me2 A T 18: 73,781,058 N467K probably damaging Het
Med23 T A 10: 24,870,121 L8Q probably damaging Het
Muc16 T A 9: 18,644,849 I3383F unknown Het
Nbas G T 12: 13,285,258 S151I probably damaging Het
Olfr1130 T A 2: 87,607,406 I6N probably benign Het
Olfr231 T A 1: 174,117,660 I119F probably damaging Het
Olfr272 C T 4: 52,910,961 A278T probably benign Het
Olfr867 G A 9: 20,054,936 H58Y probably benign Het
Olfr976 C A 9: 39,956,512 C141F probably damaging Het
Piezo1 A G 8: 122,490,894 V1305A Het
Plcb3 T C 19: 6,960,133 E639G possibly damaging Het
Polr2a A G 11: 69,743,880 L658P probably damaging Het
Prag1 A T 8: 36,104,237 Q658L possibly damaging Het
Prex2 A T 1: 11,098,588 R269S possibly damaging Het
Reln C A 5: 21,915,087 G2856* probably null Het
Rsph10b A T 5: 143,949,284 T267S possibly damaging Het
Rtn4rl1 A G 11: 75,265,224 I161V probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 G A 5: 124,381,720 P1165L possibly damaging Het
Scn3b T C 9: 40,277,098 V29A probably damaging Het
Sh3d21 T A 4: 126,163,091 T13S probably benign Het
Slc22a22 G A 15: 57,249,649 T398I probably benign Het
Slc40a1 T A 1: 45,911,528 T255S probably benign Het
Smchd1 A T 17: 71,365,219 probably null Het
Soat1 A T 1: 156,432,331 V480D probably damaging Het
Supt5 T A 7: 28,331,489 E39V unknown Het
Tapbpl T C 6: 125,226,488 probably null Het
Tlr11 A T 14: 50,362,656 I700F probably damaging Het
Tmc3 A T 7: 83,622,145 K864M possibly damaging Het
Tspan2 C A 3: 102,760,954 L168I probably benign Het
Unc13d C A 11: 116,064,807 S885I probably benign Het
Unc45a A T 7: 80,326,334 M799K possibly damaging Het
Usp34 A G 11: 23,363,097 D547G Het
Vps33b A G 7: 80,276,089 I95V probably benign Het
Other mutations in Tns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Tns1 APN 1 73924969 missense probably damaging 0.99
IGL01288:Tns1 APN 1 73953810 missense probably damaging 1.00
IGL01536:Tns1 APN 1 73919648 splice site probably benign
IGL01568:Tns1 APN 1 73953509 missense probably damaging 1.00
IGL01683:Tns1 APN 1 73953269 missense probably damaging 0.98
IGL02267:Tns1 APN 1 73992131 missense possibly damaging 0.95
IGL02597:Tns1 APN 1 73985873 critical splice donor site probably null
IGL02819:Tns1 APN 1 73937248 missense probably damaging 0.99
IGL03370:Tns1 APN 1 73985894 missense probably damaging 1.00
R0087:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
R0207:Tns1 UTSW 1 73937318 critical splice acceptor site probably null
R0411:Tns1 UTSW 1 73925761 missense probably damaging 0.96
R0543:Tns1 UTSW 1 73952697 missense probably benign 0.01
R0552:Tns1 UTSW 1 73920563 missense probably damaging 1.00
R0720:Tns1 UTSW 1 73925581 missense probably benign 0.03
R0828:Tns1 UTSW 1 73919666 missense probably damaging 1.00
R1034:Tns1 UTSW 1 73941969 missense probably damaging 1.00
R1061:Tns1 UTSW 1 73917672 missense probably damaging 1.00
R1819:Tns1 UTSW 1 73916476 splice site probably benign
R1826:Tns1 UTSW 1 73953634 start codon destroyed probably null 0.91
R2208:Tns1 UTSW 1 74079240 missense probably damaging 1.00
R3723:Tns1 UTSW 1 73924940 missense probably damaging 0.99
R4079:Tns1 UTSW 1 73995308 missense probably damaging 1.00
R4111:Tns1 UTSW 1 73941932 missense probably damaging 1.00
R4155:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4156:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4157:Tns1 UTSW 1 73914631 missense probably damaging 1.00
R4274:Tns1 UTSW 1 73928098 missense probably damaging 1.00
R4426:Tns1 UTSW 1 73985749 missense probably damaging 0.97
R4649:Tns1 UTSW 1 73953771 missense probably damaging 1.00
R4742:Tns1 UTSW 1 74124290 critical splice donor site probably null
R4869:Tns1 UTSW 1 73952615 missense probably benign
R4961:Tns1 UTSW 1 73935915 missense probably benign 0.35
R5025:Tns1 UTSW 1 73925482 missense probably damaging 1.00
R5035:Tns1 UTSW 1 73953820 start gained probably benign
R5062:Tns1 UTSW 1 73952864 missense probably damaging 1.00
R5080:Tns1 UTSW 1 73952940 missense probably damaging 1.00
R5213:Tns1 UTSW 1 73953612 missense probably damaging 1.00
R5256:Tns1 UTSW 1 73995426 intron probably benign
R5368:Tns1 UTSW 1 73941017 missense probably benign 0.07
R5391:Tns1 UTSW 1 73990409 splice site probably null
R5587:Tns1 UTSW 1 73920596 missense possibly damaging 0.94
R5735:Tns1 UTSW 1 73927979 missense probably benign 0.00
R5855:Tns1 UTSW 1 73918033 missense possibly damaging 0.83
R5999:Tns1 UTSW 1 73928097 nonsense probably null
R6122:Tns1 UTSW 1 73952419 critical splice donor site probably null
R6148:Tns1 UTSW 1 73953453 missense probably damaging 1.00
R6457:Tns1 UTSW 1 73918050 missense probably damaging 0.99
R6525:Tns1 UTSW 1 73953470 missense probably damaging 1.00
R6712:Tns1 UTSW 1 74079301 nonsense probably null
R6773:Tns1 UTSW 1 73919707 missense probably damaging 1.00
R6825:Tns1 UTSW 1 74002323 nonsense probably null
R7128:Tns1 UTSW 1 73995304 missense
R7209:Tns1 UTSW 1 73953915 missense possibly damaging 0.68
R7348:Tns1 UTSW 1 73916917 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTGATGGCTTCCCACTG -3'
(R):5'- CATCAGTGGTGAGCAGTGAC -3'

Sequencing Primer
(F):5'- ATGGCTTCCCACTGGGTGC -3'
(R):5'- AGCCCTGCAGCACTGAGTTATC -3'
Posted On2019-05-15