Incidental Mutation 'R7085:Prag1'
ID549833
Institutional Source Beutler Lab
Gene Symbol Prag1
Ensembl Gene ENSMUSG00000050271
Gene NamePEAK1 related kinase activating pseudokinase 1
SynonymsD8Ertd82e, NACK
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R7085 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location36094828-36147787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36104237 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 658 (Q658L)
Ref Sequence ENSEMBL: ENSMUSP00000106118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110492
AA Change: Q658L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: Q658L

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 395 412 N/A INTRINSIC
low complexity region 525 544 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 892 925 N/A INTRINSIC
Pfam:Pkinase_Tyr 1060 1288 1.7e-7 PFAM
Pfam:Pkinase 1061 1293 1.5e-13 PFAM
low complexity region 1363 1373 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A G 1: 26,683,465 L878P possibly damaging Het
9330159F19Rik T C 10: 29,224,480 L283P probably damaging Het
Abhd18 T C 3: 40,916,909 M132T possibly damaging Het
Afap1l1 A G 18: 61,748,814 V270A possibly damaging Het
Ankrd34a A T 3: 96,598,629 Q383L probably benign Het
Atp8b5 A G 4: 43,361,835 D627G probably damaging Het
Atrnl1 T A 19: 57,691,857 C730S probably damaging Het
Bclaf1 T C 10: 20,322,022 S4P unknown Het
Blzf1 T C 1: 164,302,324 D153G probably damaging Het
Btaf1 T C 19: 36,972,918 V516A probably benign Het
C1qa T C 4: 136,897,780 T20A probably benign Het
Cfd T G 10: 79,892,492 V229G probably damaging Het
Chd3 T A 11: 69,369,201 H64L unknown Het
Cntn3 A G 6: 102,165,401 S1002P possibly damaging Het
Cntrl T A 2: 35,165,792 C1786S probably benign Het
Cpa1 A G 6: 30,643,620 D355G probably benign Het
D130043K22Rik T C 13: 24,872,302 V539A possibly damaging Het
Ddx1 A C 12: 13,229,355 W428G probably damaging Het
Ddx49 G A 8: 70,302,483 probably benign Het
Dnhd1 T A 7: 105,715,261 V4207E probably benign Het
Dock3 A G 9: 106,901,887 S288P probably damaging Het
Drap1 G A 19: 5,424,787 probably benign Het
Ecm2 G A 13: 49,520,902 R266K probably damaging Het
Emilin2 A G 17: 71,274,105 L542S probably damaging Het
Evx1 T C 6: 52,316,692 Y282H possibly damaging Het
Fam159b G T 13: 104,858,306 T111K probably benign Het
Fbxo44 T A 4: 148,158,743 H20L probably damaging Het
Flot2 G T 11: 78,058,074 A292S possibly damaging Het
Fry A G 5: 150,438,749 I2161V probably benign Het
Gli3 T C 13: 15,715,062 F587S probably damaging Het
Gm10697 T A 3: 94,072,632 M5L probably benign Het
Gm4450 T C 3: 98,450,394 N101D probably damaging Het
Gm49368 A G 7: 128,126,857 D1147G unknown Het
Gm6970 A G 19: 47,170,662 V158A unknown Het
Gprc5b A T 7: 118,983,632 M338K probably damaging Het
Hacd3 A C 9: 64,998,243 N204K probably damaging Het
Hydin A G 8: 110,603,330 T4899A probably benign Het
Ido2 T A 8: 24,558,196 R49S probably benign Het
Igsf3 C A 3: 101,455,489 T942K probably benign Het
Kank4 T A 4: 98,779,946 Q88L probably benign Het
Krtap16-1 T A 11: 99,986,285 I98F possibly damaging Het
Laptm4a T C 12: 8,922,113 V52A probably benign Het
Lnx1 G A 5: 74,628,185 S31F possibly damaging Het
Mafa G T 15: 75,747,687 A79E unknown Het
Me2 A T 18: 73,781,058 N467K probably damaging Het
Med23 T A 10: 24,870,121 L8Q probably damaging Het
Muc16 T A 9: 18,644,849 I3383F unknown Het
Nbas G T 12: 13,285,258 S151I probably damaging Het
Olfr1130 T A 2: 87,607,406 I6N probably benign Het
Olfr231 T A 1: 174,117,660 I119F probably damaging Het
Olfr272 C T 4: 52,910,961 A278T probably benign Het
Olfr867 G A 9: 20,054,936 H58Y probably benign Het
Olfr976 C A 9: 39,956,512 C141F probably damaging Het
Piezo1 A G 8: 122,490,894 V1305A Het
Plcb3 T C 19: 6,960,133 E639G possibly damaging Het
Polr2a A G 11: 69,743,880 L658P probably damaging Het
Prex2 A T 1: 11,098,588 R269S possibly damaging Het
Reln C A 5: 21,915,087 G2856* probably null Het
Rsph10b A T 5: 143,949,284 T267S possibly damaging Het
Rtn4rl1 A G 11: 75,265,224 I161V probably benign Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Sbno1 G A 5: 124,381,720 P1165L possibly damaging Het
Scn3b T C 9: 40,277,098 V29A probably damaging Het
Sh3d21 T A 4: 126,163,091 T13S probably benign Het
Slc22a22 G A 15: 57,249,649 T398I probably benign Het
Slc40a1 T A 1: 45,911,528 T255S probably benign Het
Soat1 A T 1: 156,432,331 V480D probably damaging Het
Supt5 T A 7: 28,331,489 E39V unknown Het
Tlr11 A T 14: 50,362,656 I700F probably damaging Het
Tmc3 A T 7: 83,622,145 K864M possibly damaging Het
Tns1 G A 1: 73,925,462 P81S probably benign Het
Tspan2 C A 3: 102,760,954 L168I probably benign Het
Unc13d C A 11: 116,064,807 S885I probably benign Het
Unc45a A T 7: 80,326,334 M799K possibly damaging Het
Usp34 A G 11: 23,363,097 D547G Het
Vps33b A G 7: 80,276,089 I95V probably benign Het
Other mutations in Prag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Prag1 APN 8 36099931 missense probably benign 0.01
IGL01132:Prag1 APN 8 36146357 missense probably damaging 1.00
IGL01322:Prag1 APN 8 36103934 missense probably benign 0.01
IGL01343:Prag1 APN 8 36103046 missense possibly damaging 0.95
IGL01726:Prag1 APN 8 36102992 missense probably damaging 1.00
IGL01739:Prag1 APN 8 36102680 missense probably benign 0.00
IGL02420:Prag1 APN 8 36147426 utr 3 prime probably benign
IGL02433:Prag1 APN 8 36139568 missense probably damaging 1.00
IGL02627:Prag1 APN 8 36139439 missense possibly damaging 0.93
IGL02797:Prag1 APN 8 36139501 missense probably damaging 1.00
IGL03070:Prag1 APN 8 36103549 missense probably benign 0.01
IGL03323:Prag1 APN 8 36140008 missense probably damaging 1.00
FR4340:Prag1 UTSW 8 36103886 small insertion probably benign
FR4548:Prag1 UTSW 8 36103885 small insertion probably benign
FR4589:Prag1 UTSW 8 36103883 small insertion probably benign
FR4976:Prag1 UTSW 8 36103883 small insertion probably benign
R0325:Prag1 UTSW 8 36103804 missense probably benign 0.00
R0486:Prag1 UTSW 8 36146633 missense probably damaging 1.00
R0506:Prag1 UTSW 8 36103700 missense possibly damaging 0.92
R0507:Prag1 UTSW 8 36104123 missense probably damaging 1.00
R0595:Prag1 UTSW 8 36147002 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0885:Prag1 UTSW 8 36103267 missense probably benign 0.00
R1015:Prag1 UTSW 8 36146543 missense probably damaging 1.00
R1168:Prag1 UTSW 8 36146645 missense probably damaging 1.00
R1182:Prag1 UTSW 8 36147259 missense possibly damaging 0.95
R1227:Prag1 UTSW 8 36139951 missense probably damaging 1.00
R1282:Prag1 UTSW 8 36099914 missense probably damaging 0.96
R1469:Prag1 UTSW 8 36146298 splice site probably benign
R1656:Prag1 UTSW 8 36104346 missense probably damaging 1.00
R1660:Prag1 UTSW 8 36140023 missense possibly damaging 0.73
R1676:Prag1 UTSW 8 36102898 missense probably damaging 0.96
R1820:Prag1 UTSW 8 36103804 missense probably benign 0.00
R1970:Prag1 UTSW 8 36129160 splice site probably null
R1974:Prag1 UTSW 8 36102927 missense probably damaging 1.00
R4398:Prag1 UTSW 8 36103655 missense probably damaging 1.00
R4429:Prag1 UTSW 8 36146642 missense probably damaging 1.00
R4627:Prag1 UTSW 8 36103292 missense probably damaging 1.00
R4980:Prag1 UTSW 8 36139586 missense probably damaging 1.00
R5131:Prag1 UTSW 8 36139969 missense probably damaging 1.00
R5215:Prag1 UTSW 8 36099889 missense probably benign 0.06
R5346:Prag1 UTSW 8 36103685 missense probably damaging 1.00
R5414:Prag1 UTSW 8 36139622 missense probably benign 0.00
R5535:Prag1 UTSW 8 36104014 missense probably benign
R5687:Prag1 UTSW 8 36146813 missense probably benign 0.02
R5785:Prag1 UTSW 8 36103487 missense probably benign 0.35
R5817:Prag1 UTSW 8 36103703 missense probably damaging 1.00
R6002:Prag1 UTSW 8 36104183 missense probably benign 0.31
R6127:Prag1 UTSW 8 36147401 missense unknown
R6240:Prag1 UTSW 8 36103352 missense probably benign 0.03
R6277:Prag1 UTSW 8 36146591 missense probably damaging 1.00
R6326:Prag1 UTSW 8 36102706 missense possibly damaging 0.79
R6741:Prag1 UTSW 8 36147280 missense probably benign 0.41
R6925:Prag1 UTSW 8 36103894 missense probably damaging 1.00
R7095:Prag1 UTSW 8 36102560 missense probably benign
R7204:Prag1 UTSW 8 36146761 missense probably benign 0.03
R7213:Prag1 UTSW 8 36146615 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTTCAGTCTTGGACCAGAGG -3'
(R):5'- TCCTGAGAGGCAGCAAATG -3'

Sequencing Primer
(F):5'- GCGGCCAAGATACCAGACTG -3'
(R):5'- CAGCAAATGCAAAGGTTTCTGG -3'
Posted On2019-05-15