Incidental Mutation 'R7086:Rcc2'
ID549890
Institutional Source Beutler Lab
Gene Symbol Rcc2
Ensembl Gene ENSMUSG00000040945
Gene Nameregulator of chromosome condensation 2
SynonymsTd60, 2610529N02Rik, 2610510H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140700541-140723220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140707969 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 100 (C100R)
Ref Sequence ENSEMBL: ENSMUSP00000038144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038893] [ENSMUST00000071169] [ENSMUST00000138808]
Predicted Effect probably benign
Transcript: ENSMUST00000038893
AA Change: C100R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038144
Gene: ENSMUSG00000040945
AA Change: C100R

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
Pfam:RCC1_2 148 179 6.5e-8 PFAM
Pfam:RCC1 166 215 2.7e-18 PFAM
Pfam:RCC1_2 202 231 5.4e-10 PFAM
Pfam:RCC1 218 267 8.5e-14 PFAM
Pfam:RCC1 270 343 2.9e-13 PFAM
Pfam:RCC1_2 330 359 6.2e-9 PFAM
Pfam:RCC1 347 397 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071169
AA Change: C100R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071163
Gene: ENSMUSG00000040945
AA Change: C100R

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
Pfam:RCC1_2 148 179 6.1e-8 PFAM
Pfam:RCC1 166 215 4.1e-19 PFAM
Pfam:RCC1_2 202 231 5.1e-10 PFAM
Pfam:RCC1 218 267 1.6e-12 PFAM
Pfam:RCC1 270 343 7.5e-13 PFAM
Pfam:RCC1_2 330 359 1.3e-8 PFAM
Pfam:RCC1 347 397 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138808
AA Change: C100R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117448
Gene: ENSMUSG00000040945
AA Change: C100R

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 41 50 N/A INTRINSIC
low complexity region 65 87 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine exchange factor that is active on RalA, a small GTPase. The encoded protein and RalA are both essential for proper kinetochore-microtubule function in early mitosis. This protein has been shown to be a biomarker for colorectal cancer. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Rcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Rcc2 APN 4 140720591 missense possibly damaging 0.85
IGL02486:Rcc2 APN 4 140710362 missense probably damaging 1.00
PIT4445001:Rcc2 UTSW 4 140721149 missense possibly damaging 0.84
R0637:Rcc2 UTSW 4 140717744 splice site probably benign
R1856:Rcc2 UTSW 4 140720604 missense probably benign 0.17
R2107:Rcc2 UTSW 4 140721185 missense probably damaging 1.00
R2152:Rcc2 UTSW 4 140717117 missense probably damaging 1.00
R4809:Rcc2 UTSW 4 140717042 missense probably damaging 1.00
R5004:Rcc2 UTSW 4 140717666 missense possibly damaging 0.86
R5229:Rcc2 UTSW 4 140717029 missense probably damaging 1.00
R5384:Rcc2 UTSW 4 140720566 nonsense probably null
R5767:Rcc2 UTSW 4 140715919 missense probably damaging 1.00
R5840:Rcc2 UTSW 4 140712138 missense possibly damaging 0.95
R5909:Rcc2 UTSW 4 140717068 missense probably damaging 1.00
R6056:Rcc2 UTSW 4 140717024 missense possibly damaging 0.73
R6698:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R7252:Rcc2 UTSW 4 140702275 missense probably benign 0.00
R7393:Rcc2 UTSW 4 140717030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTGTGAAAGCTCCCAC -3'
(R):5'- CTTAAGCAATTCGCAGGGC -3'

Sequencing Primer
(F):5'- CAGGTGTGACAGTGCACACTTG -3'
(R):5'- GCAATTCGCAGGGCCTTCTC -3'
Posted On2019-05-15