Incidental Mutation 'R7086:Phox2a'
ID549895
Institutional Source Beutler Lab
Gene Symbol Phox2a
Ensembl Gene ENSMUSG00000007946
Gene Namepaired-like homeobox 2a
SynonymsArix, Pmx2, Pmx2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7086 (G1)
Quality Score212.009
Status Not validated
Chromosome7
Chromosomal Location101818313-101822726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101818511 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 5 (Y5C)
Ref Sequence ENSEMBL: ENSMUSP00000008090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008090] [ENSMUST00000035836] [ENSMUST00000165052]
Predicted Effect probably damaging
Transcript: ENSMUST00000008090
AA Change: Y5C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008090
Gene: ENSMUSG00000007946
AA Change: Y5C

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
HOX 90 152 5.75e-27 SMART
low complexity region 183 223 N/A INTRINSIC
low complexity region 225 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035836
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165052
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186316
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a paired-like homeodomain most similar to that of the Drosophila aristaless gene product. The encoded protein plays a central role in development of the autonomic nervous system. It regulates the expression of tyrosine hydroxylase and dopamine beta-hydroxylase, two catecholaminergic biosynthetic enzymes essential for the differentiation and maintenance of the noradrenergic neurotransmitter phenotype. The encoded protein has also been shown to regulate transcription of the alpha3 nicotinic acetylcholine receptor gene. Mutations in this gene have been associated with autosomal recessive congenital fibrosis of the extraocular muscles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in sensory and autonomic ganglia, lack of the locus coeruleus, and impaired migration of facial visceral motor axon. Mutants appear normal at birth but fail to nurse and die within 24 hours. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Phox2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Phox2a APN 7 101821735 missense probably damaging 0.99
R1834:Phox2a UTSW 7 101820945 unclassified probably null
R5253:Phox2a UTSW 7 101822105 missense probably benign
R5319:Phox2a UTSW 7 101820850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGGGACTCTCGGATTGGG -3'
(R):5'- AGTCACAATTACTTGCAGAGTAGG -3'

Sequencing Primer
(F):5'- AGCACTGCACTTGCGTTG -3'
(R):5'- TCACCTGCCGAGTAGGGTG -3'
Posted On2019-05-15