Incidental Mutation 'R7086:Olfr533'
ID549898
Institutional Source Beutler Lab
Gene Symbol Olfr533
Ensembl Gene ENSMUSG00000056883
Gene Nameolfactory receptor 533
SynonymsMOR252-3P, GA_x6K02T2PBJ9-42615403-42616365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140463370-140468128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140466428 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000148260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071755] [ENSMUST00000211093] [ENSMUST00000215308] [ENSMUST00000216258] [ENSMUST00000217179]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071755
AA Change: T76A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071667
Gene: ENSMUSG00000056883
AA Change: T76A

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 3e-6 PFAM
Pfam:7tm_1 41 289 5.6e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211093
AA Change: T76A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215308
AA Change: T76A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216258
AA Change: T76A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217179
AA Change: T76A

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Olfr533
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Olfr533 APN 7 140466379 missense probably damaging 0.99
IGL02582:Olfr533 APN 7 140466647 missense probably benign
IGL02954:Olfr533 APN 7 140466440 nonsense probably null
R0790:Olfr533 UTSW 7 140467049 missense possibly damaging 0.79
R1754:Olfr533 UTSW 7 140466860 missense probably damaging 1.00
R1965:Olfr533 UTSW 7 140466661 missense probably benign
R2155:Olfr533 UTSW 7 140466591 missense probably benign 0.13
R4613:Olfr533 UTSW 7 140467068 missense probably damaging 1.00
R4836:Olfr533 UTSW 7 140467076 missense probably damaging 1.00
R5493:Olfr533 UTSW 7 140466807 missense probably damaging 1.00
R5694:Olfr533 UTSW 7 140466731 missense probably benign 0.28
R6101:Olfr533 UTSW 7 140466519 missense probably benign 0.31
R6156:Olfr533 UTSW 7 140466845 missense probably benign
R6519:Olfr533 UTSW 7 140466545 missense probably benign 0.01
R6672:Olfr533 UTSW 7 140466735 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466887 missense probably damaging 1.00
R6736:Olfr533 UTSW 7 140466921 missense probably damaging 1.00
R7174:Olfr533 UTSW 7 140467163 makesense probably null
R7465:Olfr533 UTSW 7 140466798 missense probably damaging 0.99
R7486:Olfr533 UTSW 7 140466034 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTTTGTTGATGACCCCAG -3'
(R):5'- CCACACAAAGGTTGCAAGGG -3'

Sequencing Primer
(F):5'- CAGGGTCCAGGATGTTCTCTTC -3'
(R):5'- CACTCATGAGGGTGCCATAGTG -3'
Posted On2019-05-15