Incidental Mutation 'R7086:Prpsap1'
ID549911
Institutional Source Beutler Lab
Gene Symbol Prpsap1
Ensembl Gene ENSMUSG00000015869
Gene Namephosphoribosyl pyrophosphate synthetase-associated protein 1
Synonyms5730409F23Rik, PAP39
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116470845-116494202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116477283 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 234 (T234A)
Ref Sequence ENSEMBL: ENSMUSP00000101999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106391] [ENSMUST00000135196] [ENSMUST00000152496]
Predicted Effect probably benign
Transcript: ENSMUST00000106391
AA Change: T234A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101999
Gene: ENSMUSG00000015869
AA Change: T234A

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 155 4.8e-41 PFAM
Pfam:Pribosyl_synth 196 379 1.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135196
SMART Domains Protein: ENSMUSP00000119576
Gene: ENSMUSG00000015869

DomainStartEndE-ValueType
low complexity region 5 34 N/A INTRINSIC
Pfam:Pribosyltran_N 38 160 2.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152496
SMART Domains Protein: ENSMUSP00000115982
Gene: ENSMUSG00000015869

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 17 119 1.7e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Prpsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0042:Prpsap1 UTSW 11 116479656 missense probably benign 0.42
R0684:Prpsap1 UTSW 11 116471491 missense probably damaging 1.00
R1538:Prpsap1 UTSW 11 116479708 missense probably benign 0.09
R2429:Prpsap1 UTSW 11 116472235 missense probably damaging 1.00
R3415:Prpsap1 UTSW 11 116478584 missense probably benign 0.01
R3417:Prpsap1 UTSW 11 116478584 missense probably benign 0.01
R4035:Prpsap1 UTSW 11 116473008 missense probably benign 0.17
R5223:Prpsap1 UTSW 11 116488148 missense probably benign 0.09
R6216:Prpsap1 UTSW 11 116471413 missense probably damaging 1.00
R6875:Prpsap1 UTSW 11 116471438 missense probably damaging 1.00
R7159:Prpsap1 UTSW 11 116494044 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTTAAAGAGCGCTAAACAGCTC -3'
(R):5'- GAGGCGTTTATCTTCTGGCC -3'

Sequencing Primer
(F):5'- GCGCTAAACAGCTCAAAGAG -3'
(R):5'- ATAGAAATGGTTCTTTGTGCCCC -3'
Posted On2019-05-15