Incidental Mutation 'R7086:Recql4'
ID549918
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76705553 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 764 (G764V)
Ref Sequence ENSEMBL: ENSMUSP00000155694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000036852] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000230544
AA Change: G764V
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 unclassified probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4387:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5226:Recql4 UTSW 15 76710129 missense probably benign
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5824:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7449:Recql4 UTSW 15 76705565 missense unknown
R7653:Recql4 UTSW 15 76703782 missense probably benign 0.01
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCTAGGAAGTCAGTGCTGTC -3'
(R):5'- TACAACAGGCCTTCATGCGG -3'

Sequencing Primer
(F):5'- CTGTCAGCGTGGGCATGTC -3'
(R):5'- AGTGGCCACGGTAGCATTTG -3'
Posted On2019-05-15