Incidental Mutation 'R7086:Zdhhc23'
ID549923
Institutional Source Beutler Lab
Gene Symbol Zdhhc23
Ensembl Gene ENSMUSG00000036304
Gene Namezinc finger, DHHC domain containing 23
SynonymsLOC332175, LOC385651
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7086 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location43965033-43979791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43971510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 300 (I300N)
Ref Sequence ENSEMBL: ENSMUSP00000128650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036321] [ENSMUST00000165648] [ENSMUST00000231700] [ENSMUST00000232055]
Predicted Effect probably damaging
Transcript: ENSMUST00000036321
AA Change: I297N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044744
Gene: ENSMUSG00000036304
AA Change: I297N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
transmembrane domain 82 99 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 132 151 N/A INTRINSIC
Pfam:zf-DHHC 175 378 3.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165648
AA Change: I300N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128650
Gene: ENSMUSG00000036304
AA Change: I300N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
transmembrane domain 82 99 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 132 151 N/A INTRINSIC
transmembrane domain 161 180 N/A INTRINSIC
Pfam:zf-DHHC 244 378 8.4e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231700
AA Change: I300N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000232055
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Zdhhc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Zdhhc23 APN 16 43973480 missense probably damaging 1.00
R0179:Zdhhc23 UTSW 16 43973703 missense probably benign 0.06
R0180:Zdhhc23 UTSW 16 43973703 missense probably benign 0.06
R1367:Zdhhc23 UTSW 16 43974150 missense probably benign 0.04
R1557:Zdhhc23 UTSW 16 43971466 missense possibly damaging 0.63
R1997:Zdhhc23 UTSW 16 43978942 missense probably damaging 1.00
R2035:Zdhhc23 UTSW 16 43973508 missense probably damaging 1.00
R2153:Zdhhc23 UTSW 16 43973919 missense probably benign 0.03
R2497:Zdhhc23 UTSW 16 43973915 missense probably damaging 1.00
R3432:Zdhhc23 UTSW 16 43974170 splice site probably benign
R4776:Zdhhc23 UTSW 16 43973589 missense possibly damaging 0.79
R5067:Zdhhc23 UTSW 16 43973771 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTAACTCTCACTTCTGGCAAC -3'
(R):5'- TTTGTCACGCAGTAGACAGG -3'

Sequencing Primer
(F):5'- GCAACATTTATTACTTTGTCGCTGG -3'
(R):5'- CGTGAGTTACAGGAGACA -3'
Posted On2019-05-15