Incidental Mutation 'R7086:H2-Q7'
ID549927
Institutional Source Beutler Lab
Gene Symbol H2-Q7
Ensembl Gene ENSMUSG00000060550
Gene Namehistocompatibility 2, Q region locus 7
SynonymsPed, Qa7, Qa-7, H-2Q7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7086 (G1)
Quality Score213.009
Status Validated
Chromosome17
Chromosomal Location35439155-35443773 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35439485 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 33 (V33E)
Ref Sequence ENSEMBL: ENSMUSP00000071843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071951] [ENSMUST00000076256] [ENSMUST00000078205] [ENSMUST00000116598]
PDB Structure
crystal structure of the non-classical MHC class Ib Qa-2 complexed with a self peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000071951
AA Change: V33E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071843
Gene: ENSMUSG00000060550
AA Change: V33E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 3e-97 PFAM
IGc1 219 290 7.68e-23 SMART
transmembrane domain 308 330 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076256
AA Change: V33E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075606
Gene: ENSMUSG00000060550
AA Change: V33E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 3.3e-98 PFAM
IGc1 219 290 7.68e-23 SMART
low complexity region 310 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078205
AA Change: V33E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077335
Gene: ENSMUSG00000060550
AA Change: V33E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.9e-97 PFAM
IGc1 219 290 7.68e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116598
AA Change: V33E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112297
Gene: ENSMUSG00000060550
AA Change: V33E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 8.5e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: This locus controls a widely distributed lymphocyte antigen recognized by monoclonal antibody, serology or CTL assay. Using all assays, antigen is present (allele a) in C57BL/6, DBA/1, DBA/2 and SWR and absent (allele b) in AKR, C3H and BALB/c. Other strain allele typings were assay-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Wdr43 G A 17: 71,616,439 G60D probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in H2-Q7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0735:H2-Q7 UTSW 17 35440186 critical splice donor site probably null
R0839:H2-Q7 UTSW 17 35439712 missense probably damaging 1.00
R1737:H2-Q7 UTSW 17 35439626 missense probably damaging 1.00
R1831:H2-Q7 UTSW 17 35439699 missense probably benign 0.00
R1832:H2-Q7 UTSW 17 35439699 missense probably benign 0.00
R1833:H2-Q7 UTSW 17 35439699 missense probably benign 0.00
R2047:H2-Q7 UTSW 17 35440147 missense probably damaging 1.00
R4498:H2-Q7 UTSW 17 35439530 missense probably damaging 1.00
R4657:H2-Q7 UTSW 17 35442759 missense possibly damaging 0.86
R4784:H2-Q7 UTSW 17 35439938 missense probably damaging 1.00
R5387:H2-Q7 UTSW 17 35439542 missense probably damaging 1.00
R5499:H2-Q7 UTSW 17 35439940 nonsense probably null
R6410:H2-Q7 UTSW 17 35440176 missense probably benign 0.13
R6457:H2-Q7 UTSW 17 35439679 missense probably damaging 1.00
R6720:H2-Q7 UTSW 17 35442678 missense probably benign 0.05
R6943:H2-Q7 UTSW 17 35439584 missense probably benign 0.30
R7069:H2-Q7 UTSW 17 35440031 missense probably damaging 0.98
R7303:H2-Q7 UTSW 17 35440061 missense probably benign 0.13
R7520:H2-Q7 UTSW 17 35442710 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AACAATGCTGCTCTTGCTGG -3'
(R):5'- AACTCTGCTCATGGCCCTTG -3'

Sequencing Primer
(F):5'- TGACCCTGATCGAGACCC -3'
(R):5'- GCCCTTGGCGATCTGTGTC -3'
Posted On2019-05-15