Incidental Mutation 'R7086:Wdr43'
ID549930
Institutional Source Beutler Lab
Gene Symbol Wdr43
Ensembl Gene ENSMUSG00000041057
Gene NameWD repeat domain 43
Synonyms2610318G08Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_175639.1; MGI:1919765

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7086 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71616215-71659031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71616439 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 60 (G60D)
Ref Sequence ENSEMBL: ENSMUSP00000048337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047086]
Predicted Effect probably benign
Transcript: ENSMUST00000047086
AA Change: G60D

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000048337
Gene: ENSMUSG00000041057
AA Change: G60D

DomainStartEndE-ValueType
WD40 8 42 4.42e1 SMART
WD40 45 110 2.2e2 SMART
WD40 113 154 7.85e-7 SMART
WD40 157 194 1.24e-4 SMART
WD40 197 249 5.52e0 SMART
Blast:WD40 256 299 1e-18 BLAST
low complexity region 320 334 N/A INTRINSIC
Pfam:Utp12 472 575 2.3e-23 PFAM
coiled coil region 635 663 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (60/61)
Allele List at MGI

All alleles(36) : Gene trapped(36)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A G 3: 98,161,319 H28R probably damaging Het
Adgre4 T C 17: 55,820,649 I563T probably benign Het
Ankub1 A T 3: 57,690,325 C75S probably damaging Het
Antxrl G A 14: 34,065,916 V299I probably benign Het
Arfgef2 T A 2: 166,876,616 C1442S probably damaging Het
Atp13a3 T C 16: 30,351,063 D399G possibly damaging Het
Cacna2d1 T A 5: 16,349,416 Y666N probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Chrng C A 1: 87,211,013 R455S probably benign Het
Cluh T A 11: 74,667,340 H1155Q possibly damaging Het
Col16a1 G A 4: 130,052,980 probably null Het
Cpne5 G A 17: 29,159,077 P576L unknown Het
Crocc C A 4: 141,047,057 V144L possibly damaging Het
Cubn A G 2: 13,319,858 V2781A probably damaging Het
Cyp8b1 A G 9: 121,915,289 F326L probably benign Het
Dclk1 G A 3: 55,487,912 probably null Het
Dnah7c A G 1: 46,750,125 R3303G probably benign Het
Dnhd1 G T 7: 105,708,532 R3191S probably benign Het
Fgfbp3 T G 19: 36,918,703 S172R possibly damaging Het
Gpr158 G A 2: 21,826,575 V829I probably benign Het
Gtse1 A G 15: 85,875,549 D647G probably damaging Het
H2-Q7 T A 17: 35,439,485 V33E probably damaging Het
Hydin A G 8: 110,600,245 T4739A possibly damaging Het
Kcnip1 G T 11: 33,634,629 P175T probably damaging Het
Klhl10 T C 11: 100,456,942 V608A probably benign Het
Klhl2 A G 8: 64,823,012 Y80H probably damaging Het
Lnx2 A T 5: 147,020,178 probably null Het
Lst1 G A 17: 35,185,286 H59Y probably damaging Het
Maats1 A T 16: 38,306,857 F512L possibly damaging Het
Mphosph8 G C 14: 56,668,523 V58L possibly damaging Het
Mpnd C A 17: 56,009,457 S45R possibly damaging Het
Myh8 A G 11: 67,292,627 probably null Het
Odf3 A G 7: 140,849,489 H151R probably benign Het
Olfr1263 A G 2: 90,015,250 I107V probably benign Het
Olfr533 A G 7: 140,466,428 T76A possibly damaging Het
Phox2a A G 7: 101,818,511 Y5C probably damaging Het
Pkdrej A G 15: 85,820,116 S540P probably damaging Het
Plcb4 A G 2: 136,007,847 M1133V probably benign Het
Plxnc1 T C 10: 94,831,435 M1126V probably benign Het
Ppm1l A G 3: 69,317,853 Y96C probably damaging Het
Prpsap1 T C 11: 116,477,283 T234A probably benign Het
R3hcc1l T C 19: 42,581,970 V668A probably damaging Het
Rapgef2 A G 3: 79,086,046 S712P probably benign Het
Rcc2 T C 4: 140,707,969 C100R probably benign Het
Recql4 C A 15: 76,705,553 G764V unknown Het
Rlbp1 A G 7: 79,380,065 I140T possibly damaging Het
Samsn1 T C 16: 75,870,906 T261A probably benign Het
Sgtb T C 13: 104,118,416 S65P possibly damaging Het
Spag9 T C 11: 94,097,864 V920A probably benign Het
Spata31 T A 13: 64,922,229 S730R probably benign Het
Spta1 C T 1: 174,199,484 A841V probably damaging Het
St5 A G 7: 109,525,574 I1083T probably damaging Het
Tnfaip1 T C 11: 78,525,439 S273G probably benign Het
Vezf1 T C 11: 88,078,538 V371A probably benign Het
Vmn1r67 G A 7: 10,447,117 V103I possibly damaging Het
Vmn2r87 G T 10: 130,497,309 T24K probably benign Het
Xkr4 G A 1: 3,216,962 T335I probably damaging Het
Zdhhc23 A T 16: 43,971,510 I300N probably damaging Het
Zfp729b T C 13: 67,592,937 K403R probably damaging Het
Other mutations in Wdr43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdr43 APN 17 71652814 missense probably damaging 1.00
IGL02077:Wdr43 APN 17 71640291 missense probably benign 0.00
IGL02114:Wdr43 APN 17 71652848 missense probably benign 0.00
IGL02252:Wdr43 APN 17 71626850 missense probably damaging 1.00
IGL02352:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL02359:Wdr43 APN 17 71632048 missense possibly damaging 0.90
IGL03082:Wdr43 APN 17 71638341 missense probably damaging 0.99
IGL03095:Wdr43 APN 17 71641287 missense probably benign 0.28
IGL02837:Wdr43 UTSW 17 71642736 missense probably benign 0.00
R0039:Wdr43 UTSW 17 71653492 nonsense probably null
R0164:Wdr43 UTSW 17 71631997 splice site probably benign
R0271:Wdr43 UTSW 17 71626825 missense probably benign 0.00
R1117:Wdr43 UTSW 17 71616387 missense probably benign 0.35
R1873:Wdr43 UTSW 17 71633652 missense probably benign 0.05
R1973:Wdr43 UTSW 17 71640240 missense probably benign 0.00
R3620:Wdr43 UTSW 17 71650606 missense probably benign 0.13
R3922:Wdr43 UTSW 17 71638301 splice site probably benign
R4097:Wdr43 UTSW 17 71657537 missense probably benign
R5067:Wdr43 UTSW 17 71626854 missense probably benign
R5282:Wdr43 UTSW 17 71648777 missense probably damaging 1.00
R6251:Wdr43 UTSW 17 71650053 splice site probably null
R6364:Wdr43 UTSW 17 71657654 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACGACCAGCCACTTCTTG -3'
(R):5'- AGAGGCTTCGATGAACATGG -3'

Sequencing Primer
(F):5'- ACTTCTTGGGCTCTCAGCG -3'
(R):5'- TTCGATGAACATGGCGGCC -3'
Posted On2019-05-15