Incidental Mutation 'R7087:Arhgef4'
ID549933
Institutional Source Beutler Lab
Gene Symbol Arhgef4
Ensembl Gene ENSMUSG00000037509
Gene NameRho guanine nucleotide exchange factor (GEF) 4
Synonyms9330140K16Rik, Asef
MMRRC Submission
Accession Numbers

Genbank: NM_183019; MGI: 2442507; Ensembl: ENSMUSG00000070955

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7087 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34678188-34813309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34811686 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 438 (R438W)
Ref Sequence ENSEMBL: ENSMUSP00000035980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000047664] [ENSMUST00000159021] [ENSMUST00000159747] [ENSMUST00000160855] [ENSMUST00000162599] [ENSMUST00000167518]
Predicted Effect probably benign
Transcript: ENSMUST00000047534
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047664
AA Change: R438W

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035980
Gene: ENSMUSG00000037509
AA Change: R438W

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
RhoGEF 82 261 3.86e-56 SMART
PH 294 402 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159021
SMART Domains Protein: ENSMUSP00000124467
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 190 3.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159747
AA Change: R1809W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124213
Gene: ENSMUSG00000037509
AA Change: R1809W

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 686 712 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 1119 1137 N/A INTRINSIC
low complexity region 1240 1254 N/A INTRINSIC
SH3 1361 1416 3.73e-16 SMART
RhoGEF 1453 1632 3.86e-56 SMART
PH 1665 1773 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160855
SMART Domains Protein: ENSMUSP00000124207
Gene: ENSMUSG00000037509

DomainStartEndE-ValueType
SH3 1 45 6.97e-7 SMART
Pfam:RhoGEF 82 187 1.2e-21 PFAM
low complexity region 194 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162599
AA Change: R582W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124906
Gene: ENSMUSG00000037509
AA Change: R582W

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
SH3 194 249 3.73e-16 SMART
Pfam:RhoGEF 304 405 1.2e-25 PFAM
PH 438 546 2.33e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167518
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The protein encoded by this gene may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased angiogenesis, vascular endothelial cell migration, tumor growth, and tumor vascularization. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 T A 7: 119,774,647 V252D probably damaging Het
Adprhl1 A G 8: 13,221,856 L1634P probably damaging Het
Asb3 A C 11: 30,998,321 K38T probably benign Het
Atp1a4 A T 1: 172,246,702 L328Q probably damaging Het
BC030500 T A 8: 58,912,354 I13N unknown Het
Cbarp A G 10: 80,136,408 S136P probably damaging Het
Ccdc18 T A 5: 108,196,122 D910E probably benign Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Cmya5 A G 13: 93,090,975 V2535A probably benign Het
Ddx39b C T 17: 35,253,049 R355C probably damaging Het
Dock10 T C 1: 80,592,826 T338A probably benign Het
Dpysl3 T C 18: 43,363,530 D147G probably damaging Het
Eif3i G T 4: 129,592,311 H284Q probably damaging Het
Erbb4 A T 1: 68,740,491 L42Q probably null Het
Exoc3l2 A G 7: 19,469,657 E58G Het
Fgf18 C T 11: 33,124,677 R98Q probably damaging Het
Gm14548 G A 7: 3,897,219 A128V probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gp2 T A 7: 119,450,232 T361S probably damaging Het
Gtsf1 A T 15: 103,425,449 H33Q probably damaging Het
Hoxa4 G A 6: 52,191,291 T133M probably damaging Het
Hspb7 C A 4: 141,422,555 T84K possibly damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Kdm7a C T 6: 39,175,381 R127H probably benign Het
Lsm10 C T 4: 126,098,159 R103C probably damaging Het
Mgme1 T C 2: 144,272,181 S68P probably damaging Het
Nes G T 3: 87,979,758 V1775L probably benign Het
Nfrkb C T 9: 31,419,932 Q1250* probably null Het
Olfr1191-ps1 T C 2: 88,642,853 F29L probably damaging Het
Phf21b A T 15: 84,791,832 L338H probably damaging Het
Ppp2r5b A G 19: 6,232,550 V190A possibly damaging Het
Prmt1 T C 7: 44,981,583 probably null Het
Rusc1 A G 3: 89,089,492 V639A probably damaging Het
Slc24a2 T A 4: 86,991,219 probably null Het
Slc39a10 T C 1: 46,835,720 T141A probably damaging Het
Spta1 A T 1: 174,174,510 M69L probably benign Het
St8sia5 A C 18: 77,254,542 Q316P possibly damaging Het
Svs3a T C 2: 164,289,797 I96T possibly damaging Het
Syne1 T A 10: 5,542,024 probably benign Het
Trappc3 T C 4: 126,272,681 S16P probably benign Het
Vmn2r44 A T 7: 8,378,367 F176I probably benign Het
Wnk1 C T 6: 120,037,530 E35K possibly damaging Het
Zfp354c A G 11: 50,815,213 L345P probably damaging Het
Zfp608 T A 18: 54,899,397 K490N probably damaging Het
Zfp687 A C 3: 95,010,213 S709A probably benign Het
Other mutations in Arhgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Arhgef4 APN 1 34811696 missense possibly damaging 0.88
IGL02376:Arhgef4 APN 1 34806059 missense probably damaging 1.00
IGL02604:Arhgef4 APN 1 34811723 nonsense probably null
IGL03240:Arhgef4 APN 1 34806026 missense probably benign 0.03
R0095:Arhgef4 UTSW 1 34732370 nonsense probably null
R0157:Arhgef4 UTSW 1 34806394 missense probably damaging 1.00
R0243:Arhgef4 UTSW 1 34806999 intron probably null
R0383:Arhgef4 UTSW 1 34810533 missense probably damaging 1.00
R0440:Arhgef4 UTSW 1 34745448 splice site probably null
R0452:Arhgef4 UTSW 1 34732322 missense probably damaging 0.97
R0893:Arhgef4 UTSW 1 34807110 missense probably damaging 1.00
R1429:Arhgef4 UTSW 1 34810339 missense probably damaging 1.00
R1437:Arhgef4 UTSW 1 34723945 missense unknown
R1669:Arhgef4 UTSW 1 34732158 missense possibly damaging 0.86
R1780:Arhgef4 UTSW 1 34724160 missense possibly damaging 0.73
R1809:Arhgef4 UTSW 1 34810555 critical splice donor site probably null
R1879:Arhgef4 UTSW 1 34722440 missense unknown
R1908:Arhgef4 UTSW 1 34724259 missense probably benign 0.01
R1919:Arhgef4 UTSW 1 34811140 missense probably damaging 0.98
R2020:Arhgef4 UTSW 1 34723810 missense unknown
R2058:Arhgef4 UTSW 1 34722377 missense unknown
R2213:Arhgef4 UTSW 1 34807149 unclassified probably null
R2851:Arhgef4 UTSW 1 34724048 missense unknown
R2852:Arhgef4 UTSW 1 34724048 missense unknown
R2853:Arhgef4 UTSW 1 34724048 missense unknown
R3697:Arhgef4 UTSW 1 34722440 missense unknown
R4012:Arhgef4 UTSW 1 34725106 missense possibly damaging 0.75
R4118:Arhgef4 UTSW 1 34732347 missense probably damaging 0.98
R4133:Arhgef4 UTSW 1 34806104 missense probably damaging 1.00
R4534:Arhgef4 UTSW 1 34723081 missense unknown
R4535:Arhgef4 UTSW 1 34723081 missense unknown
R4581:Arhgef4 UTSW 1 34732124 missense possibly damaging 0.83
R4665:Arhgef4 UTSW 1 34806032 missense possibly damaging 0.89
R4678:Arhgef4 UTSW 1 34722668 missense unknown
R4684:Arhgef4 UTSW 1 34811785 unclassified probably null
R4706:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
R4745:Arhgef4 UTSW 1 34807275 missense probably damaging 1.00
R4747:Arhgef4 UTSW 1 34723274 missense unknown
R4988:Arhgef4 UTSW 1 34723454 missense unknown
R5063:Arhgef4 UTSW 1 34724215 missense probably benign 0.00
R5154:Arhgef4 UTSW 1 34732374 missense probably benign 0.43
R5156:Arhgef4 UTSW 1 34723274 missense unknown
R5263:Arhgef4 UTSW 1 34724997 missense possibly damaging 0.84
R5450:Arhgef4 UTSW 1 34807324 intron probably benign
R5807:Arhgef4 UTSW 1 34807615 intron probably benign
R5863:Arhgef4 UTSW 1 34722845 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6034:Arhgef4 UTSW 1 34721903 missense unknown
R6311:Arhgef4 UTSW 1 34723981 missense unknown
R6315:Arhgef4 UTSW 1 34723477 missense unknown
R6316:Arhgef4 UTSW 1 34723477 missense unknown
R6318:Arhgef4 UTSW 1 34723477 missense unknown
R6323:Arhgef4 UTSW 1 34723477 missense unknown
R6324:Arhgef4 UTSW 1 34723477 missense unknown
R6325:Arhgef4 UTSW 1 34723477 missense unknown
R6340:Arhgef4 UTSW 1 34732223 missense probably damaging 1.00
R6835:Arhgef4 UTSW 1 34806493 missense probably damaging 1.00
R6981:Arhgef4 UTSW 1 34722452 missense unknown
R7297:Arhgef4 UTSW 1 34807192 missense probably damaging 1.00
X0062:Arhgef4 UTSW 1 34724227 missense probably benign 0.35
YA93:Arhgef4 UTSW 1 34732217 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCAGACATTCCATGCCTTG -3'
(R):5'- ACAAAGTGCTGTCAGGTTGTC -3'

Sequencing Primer
(F):5'- ATGCCTTGGACCGTGGC -3'
(R):5'- CTGATGGATGCTGGCTCAC -3'
Posted On2019-05-15