Incidental Mutation 'R7088:Lama3'
ID550049
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7088 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12582545 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1686 (V1686A)
Ref Sequence ENSEMBL: ENSMUSP00000140104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070] [ENSMUST00000188815]
Predicted Effect probably benign
Transcript: ENSMUST00000092070
AA Change: V3292A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: V3292A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188815
AA Change: V1686A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140104
Gene: ENSMUSG00000024421
AA Change: V1686A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_Lam 78 122 2.66e-10 SMART
EGF_Lam 125 175 7.81e-8 SMART
Pfam:Laminin_I 230 496 1e-90 PFAM
low complexity region 579 594 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
LamG 800 960 1.67e-2 SMART
LamG 1008 1136 1.72e-17 SMART
LamG 1179 1294 3.96e-17 SMART
LamG 1399 1527 1.12e-34 SMART
LamG 1569 1702 3.41e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Epm2a T A 10: 11,343,770 probably null Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
Camelid UTSW 18 12419257 critical splice donor site probably null
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0325:Lama3 UTSW 18 12482126 missense probably damaging 1.00
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6060:Lama3 UTSW 18 12556663 missense probably damaging 0.99
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGCTTTGCTACCTCTGTATCAC -3'
(R):5'- AGAGATCTGTACAGCACTGTGTG -3'

Sequencing Primer
(F):5'- TATCACAGAAGGCAGGAGGTCC -3'
(R):5'- CTATGACAGCTTGATGGTTTTGAATG -3'
Posted On2019-05-15