Incidental Mutation 'R0615:Bckdha'
ID55017
Institutional Source Beutler Lab
Gene Symbol Bckdha
Ensembl Gene ENSMUSG00000060376
Gene Namebranched chain ketoacid dehydrogenase E1, alpha polypeptide
SynonymsBCKAD E1[a]
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25629946-25658981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25641785 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000071292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071329]
Predicted Effect probably benign
Transcript: ENSMUST00000071329
AA Change: D50E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000071292
Gene: ENSMUSG00000060376
AA Change: D50E

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Pfam:E1_dh 107 407 2.9e-117 PFAM
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Bckdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Bckdha APN 7 25633342 missense probably benign 0.00
IGL01322:Bckdha APN 7 25658707 missense possibly damaging 0.75
IGL02279:Bckdha APN 7 25631109 missense probably damaging 1.00
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0194:Bckdha UTSW 7 25631450 missense probably damaging 1.00
R1806:Bckdha UTSW 7 25631420 missense probably damaging 1.00
R2520:Bckdha UTSW 7 25641699 missense probably benign 0.18
R3847:Bckdha UTSW 7 25631652 missense probably damaging 1.00
R3975:Bckdha UTSW 7 25631433 missense probably damaging 1.00
R4630:Bckdha UTSW 7 25631459 missense probably damaging 1.00
R5655:Bckdha UTSW 7 25630364 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTCCGGTAGAACTTCAGCAC -3'
(R):5'- TTTGAGACCGAGTAGCTCACGGTG -3'

Sequencing Primer
(F):5'- GGTAGAACTTCAGCACCTCCTC -3'
(R):5'- CTGATAAAGCGCTCTTTGCC -3'
Posted On2013-07-11