Incidental Mutation 'R7091:Smg5'
ID550197
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene NameSmg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88336260-88362338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88351347 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 542 (P542S)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451]
Predicted Effect probably benign
Transcript: ENSMUST00000001451
AA Change: P542S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: P542S

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192009
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88351428 nonsense probably null
IGL00902:Smg5 APN 3 88353085 missense probably benign 0.00
IGL00990:Smg5 APN 3 88343038 critical splice donor site probably null
IGL01371:Smg5 APN 3 88359644 unclassified probably benign
IGL01536:Smg5 APN 3 88349245 missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88352998 missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88346452 nonsense probably null
R0013:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0129:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0153:Smg5 UTSW 3 88353872 unclassified probably benign
R1386:Smg5 UTSW 3 88355671 missense probably damaging 1.00
R1941:Smg5 UTSW 3 88345380 missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88351561 missense probably benign
R2282:Smg5 UTSW 3 88345398 missense probably benign 0.02
R3615:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R3616:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4008:Smg5 UTSW 3 88349158 missense probably benign 0.01
R4687:Smg5 UTSW 3 88342469 missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88355692 nonsense probably null
R4802:Smg5 UTSW 3 88355692 nonsense probably null
R4977:Smg5 UTSW 3 88355725 nonsense probably null
R5384:Smg5 UTSW 3 88351293 missense probably damaging 1.00
R5443:Smg5 UTSW 3 88354589 missense probably damaging 0.99
R5779:Smg5 UTSW 3 88351618 unclassified probably benign
R5860:Smg5 UTSW 3 88342907 missense probably damaging 0.97
R6080:Smg5 UTSW 3 88351509 missense probably benign
R6263:Smg5 UTSW 3 88341901 missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88351220 missense probably benign 0.00
R6722:Smg5 UTSW 3 88353025 missense probably damaging 0.99
R6847:Smg5 UTSW 3 88342552 missense probably damaging 1.00
R6950:Smg5 UTSW 3 88349269 critical splice donor site probably null
R7395:Smg5 UTSW 3 88361071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGTGATGACAGTGACCTG -3'
(R):5'- CCACACTGTTAGGTTCCGTG -3'

Sequencing Primer
(F):5'- TGAATCTGACTCTAGCCATGAC -3'
(R):5'- TCCGTGGTGGGCTGCAG -3'
Posted On2019-05-15