Incidental Mutation 'R7091:Gm4778'
ID550199
Institutional Source Beutler Lab
Gene Symbol Gm4778
Ensembl Gene ENSMUSG00000089696
Gene Namepredicted gene 4778
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location94264036-94266784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94266638 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 314 (F314L)
Ref Sequence ENSEMBL: ENSMUSP00000123868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098878] [ENSMUST00000159517]
Predicted Effect probably damaging
Transcript: ENSMUST00000098878
AA Change: F318L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096477
Gene: ENSMUSG00000089696
AA Change: F318L

DomainStartEndE-ValueType
MATH 25 134 6.01e-8 SMART
BTB 192 291 7.66e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159517
AA Change: F314L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123868
Gene: ENSMUSG00000089696
AA Change: F314L

DomainStartEndE-ValueType
MATH 21 130 6.01e-8 SMART
BTB 188 287 7.66e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Gm4778
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01767:Gm4778 APN 3 94266484 missense probably benign 0.00
IGL02032:Gm4778 APN 3 94266333 missense probably damaging 1.00
IGL02694:Gm4778 APN 3 94266152 missense probably benign
IGL03171:Gm4778 APN 3 94266455 missense probably benign 0.00
R0195:Gm4778 UTSW 3 94265922 missense possibly damaging 0.79
R0739:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1064:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1149:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1150:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1152:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1284:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1286:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1287:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1349:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1358:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1372:Gm4778 UTSW 3 94266128 missense possibly damaging 0.94
R1383:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1399:Gm4778 UTSW 3 94265795 missense probably benign 0.17
R1756:Gm4778 UTSW 3 94266218 missense probably benign
R1996:Gm4778 UTSW 3 94265711 missense probably benign 0.00
R2679:Gm4778 UTSW 3 94265910 missense probably damaging 1.00
R2878:Gm4778 UTSW 3 94266480 missense possibly damaging 0.69
R5108:Gm4778 UTSW 3 94265835 missense probably damaging 1.00
R5706:Gm4778 UTSW 3 94266652 missense possibly damaging 0.91
R6251:Gm4778 UTSW 3 94265901 missense probably damaging 1.00
R6928:Gm4778 UTSW 3 94266548 missense probably benign 0.31
R7264:Gm4778 UTSW 3 94265738 missense possibly damaging 0.86
R7503:Gm4778 UTSW 3 94266473 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGCTTCATTTACACTGGG -3'
(R):5'- TTGGAAGACAGATGTTGGTCATAG -3'

Sequencing Primer
(F):5'- GCTTCATTTACACTGGGAAGGCAC -3'
(R):5'- CAGATGTTGGTCATAGATTTCCATCC -3'
Posted On2019-05-15