Incidental Mutation 'R7091:Tut1'
ID550242
Institutional Source Beutler Lab
Gene Symbol Tut1
Ensembl Gene ENSMUSG00000071645
Gene Nameterminal uridylyl transferase 1, U6 snRNA-specific
SynonymsPAPD2, Rbm21, 2700038E08Rik, TUTase6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8953850-8966207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8965811 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 754 (H754R)
Ref Sequence ENSEMBL: ENSMUSP00000093958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052248] [ENSMUST00000096239]
Predicted Effect probably benign
Transcript: ENSMUST00000052248
SMART Domains Protein: ENSMUSP00000093955
Gene: ENSMUSG00000071644

DomainStartEndE-ValueType
Pfam:GST_N 2 81 1.5e-25 PFAM
Pfam:GST_N_3 6 83 1.4e-8 PFAM
Pfam:GST_C_3 88 194 8.3e-13 PFAM
Pfam:GST_C 106 198 4.5e-22 PFAM
Pfam:GST_C_2 125 191 8.6e-12 PFAM
low complexity region 238 262 N/A INTRINSIC
EF1G 275 381 3.63e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096239
AA Change: H754R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093958
Gene: ENSMUSG00000071645
AA Change: H754R

DomainStartEndE-ValueType
ZnF_C2H2 16 40 1.53e-1 SMART
RRM 57 124 2.02e-10 SMART
SCOP:d1f5aa2 173 221 1e-3 SMART
low complexity region 242 258 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 324 347 N/A INTRINSIC
low complexity region 423 434 N/A INTRINSIC
Pfam:PAP_assoc 493 552 2.7e-8 PFAM
low complexity region 594 618 N/A INTRINSIC
low complexity region 767 782 N/A INTRINSIC
Meta Mutation Damage Score 0.1948 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Tut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tut1 APN 19 8959096 missense probably damaging 1.00
IGL01934:Tut1 APN 19 8953991 missense probably damaging 1.00
IGL01980:Tut1 APN 19 8954000 missense probably damaging 1.00
IGL02115:Tut1 APN 19 8965312 missense probably damaging 1.00
IGL02375:Tut1 APN 19 8964039 missense probably damaging 1.00
IGL02683:Tut1 APN 19 8965258 missense probably benign 0.31
IGL02899:Tut1 APN 19 8962387 missense probably damaging 1.00
IGL02953:Tut1 APN 19 8962692 missense probably damaging 1.00
PIT4280001:Tut1 UTSW 19 8959262 missense probably benign 0.00
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0014:Tut1 UTSW 19 8962447 missense possibly damaging 0.61
R0033:Tut1 UTSW 19 8962759 missense probably benign 0.03
R0091:Tut1 UTSW 19 8965436 missense probably damaging 0.97
R0173:Tut1 UTSW 19 8965483 nonsense probably null
R0362:Tut1 UTSW 19 8955527 missense possibly damaging 0.94
R0371:Tut1 UTSW 19 8962773 missense probably damaging 0.98
R0386:Tut1 UTSW 19 8955555 missense probably benign 0.00
R1022:Tut1 UTSW 19 8959355 missense probably benign
R1024:Tut1 UTSW 19 8959355 missense probably benign
R1539:Tut1 UTSW 19 8965486 missense probably benign 0.02
R1921:Tut1 UTSW 19 8966102 missense probably benign
R1958:Tut1 UTSW 19 8959313 missense probably damaging 1.00
R2508:Tut1 UTSW 19 8955567 missense probably damaging 0.98
R4757:Tut1 UTSW 19 8959308 missense possibly damaging 0.83
R5104:Tut1 UTSW 19 8959334 missense probably benign 0.03
R5185:Tut1 UTSW 19 8955450 missense probably benign 0.07
R6999:Tut1 UTSW 19 8966018 missense probably damaging 1.00
R7084:Tut1 UTSW 19 8965414 missense probably benign
R7313:Tut1 UTSW 19 8964049 missense probably benign 0.00
R7361:Tut1 UTSW 19 8965334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCGAGAGACACCTCAG -3'
(R):5'- ACAGTGAGTGTCTGCTCAGC -3'

Sequencing Primer
(F):5'- TTCGAGAGACACCTCAGGACTG -3'
(R):5'- GCAGATGCCACAAAGCTG -3'
Posted On2019-05-15