Incidental Mutation 'R7092:Mfsd4a'
ID550248
Institutional Source Beutler Lab
Gene Symbol Mfsd4a
Ensembl Gene ENSMUSG00000059149
Gene Namemajor facilitator superfamily domain containing 4A
SynonymsMfsd4, A930031D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7092 (G1)
Quality Score184.009
Status Validated
Chromosome1
Chromosomal Location132022806-132068062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132067663 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 77 (T77N)
Ref Sequence ENSEMBL: ENSMUSP00000116282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046658] [ENSMUST00000112365] [ENSMUST00000112370] [ENSMUST00000126927] [ENSMUST00000144548] [ENSMUST00000146267] [ENSMUST00000159038] [ENSMUST00000160656] [ENSMUST00000161864]
Predicted Effect unknown
Transcript: ENSMUST00000046658
AA Change: T77N
SMART Domains Protein: ENSMUSP00000039635
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 99 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 245 267 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 309 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112365
AA Change: T77N

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107984
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
Pfam:MFS_1 21 430 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112370
AA Change: T77N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107989
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126927
AA Change: T77N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144548
AA Change: T77N

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116282
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
Pfam:MFS_1 21 396 4.2e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146267
AA Change: T77K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117864
Gene: ENSMUSG00000059149
AA Change: T77K

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159038
AA Change: T77N

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125558
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
Pfam:MFS_1 20 395 6.8e-12 PFAM
transmembrane domain 398 420 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160656
AA Change: T55N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125138
Gene: ENSMUSG00000059149
AA Change: T55N

DomainStartEndE-ValueType
transmembrane domain 2 20 N/A INTRINSIC
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 85 104 N/A INTRINSIC
transmembrane domain 196 218 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
transmembrane domain 292 314 N/A INTRINSIC
transmembrane domain 327 349 N/A INTRINSIC
transmembrane domain 354 376 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161864
AA Change: T77N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124961
Gene: ENSMUSG00000059149
AA Change: T77N

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
transmembrane domain 55 74 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
Pfam:MFS_1 218 420 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
Atad5 T A 11: 80,120,720 N1307K possibly damaging Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 I190N probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pde4b G A 4: 102,601,851 V523M probably damaging Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Ppme1 A T 7: 100,371,822 M1K probably null Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Rnf123 C A 9: 108,068,600 R329L probably benign Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slc12a4 G T 8: 105,945,223 A922D probably damaging Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Mfsd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Mfsd4a APN 1 132040594 missense probably benign 0.34
IGL01348:Mfsd4a APN 1 132067826 missense probably null 0.96
IGL01621:Mfsd4a APN 1 132054143 missense probably benign 0.16
IGL01934:Mfsd4a APN 1 132046311 missense probably damaging 1.00
IGL02429:Mfsd4a APN 1 132028499 missense probably benign
R0362:Mfsd4a UTSW 1 132059275 missense probably damaging 1.00
R0551:Mfsd4a UTSW 1 132041919 missense probably damaging 1.00
R1435:Mfsd4a UTSW 1 132067756 missense probably damaging 1.00
R1566:Mfsd4a UTSW 1 132059179 missense probably damaging 1.00
R1739:Mfsd4a UTSW 1 132067883 missense possibly damaging 0.85
R1793:Mfsd4a UTSW 1 132059339 missense probably damaging 0.98
R1799:Mfsd4a UTSW 1 132053596 missense possibly damaging 0.63
R2244:Mfsd4a UTSW 1 132028505 missense probably benign 0.09
R3870:Mfsd4a UTSW 1 132046353 missense probably damaging 0.99
R4177:Mfsd4a UTSW 1 132040557 missense probably damaging 0.99
R4330:Mfsd4a UTSW 1 132053553 missense possibly damaging 0.71
R4705:Mfsd4a UTSW 1 132053571 missense probably damaging 1.00
R4717:Mfsd4a UTSW 1 132057895 missense probably benign 0.00
R5886:Mfsd4a UTSW 1 132067727 missense probably damaging 0.96
R5890:Mfsd4a UTSW 1 132038928 missense probably damaging 1.00
R7189:Mfsd4a UTSW 1 132052393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTCTTACGCATCTCTG -3'
(R):5'- ACTGGAGCGTCTTCTTCAGC -3'

Sequencing Primer
(F):5'- CGAAAGGGTTCTGAGCTCTCTC -3'
(R):5'- AGCTTCGGCCTGTGCATC -3'
Posted On2019-05-15