Incidental Mutation 'R7092:Pde4b'
ID550269
Institutional Source Beutler Lab
Gene Symbol Pde4b
Ensembl Gene ENSMUSG00000028525
Gene Namephosphodiesterase 4B, cAMP specific
Synonymsdunce, Dpde4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R7092 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location102087543-102607259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102601851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 523 (V523M)
Ref Sequence ENSEMBL: ENSMUSP00000102521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030251] [ENSMUST00000097949] [ENSMUST00000097950] [ENSMUST00000106901] [ENSMUST00000106904] [ENSMUST00000106908] [ENSMUST00000106911]
Predicted Effect probably damaging
Transcript: ENSMUST00000030251
AA Change: V286M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030251
Gene: ENSMUSG00000028525
AA Change: V286M

DomainStartEndE-ValueType
HDc 151 326 2.35e-5 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097949
AA Change: V305M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095561
Gene: ENSMUSG00000028525
AA Change: V305M

DomainStartEndE-ValueType
HDc 170 345 2.35e-5 SMART
low complexity region 452 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097950
AA Change: V366M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095562
Gene: ENSMUSG00000028525
AA Change: V366M

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
HDc 231 406 2.35e-5 SMART
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106901
AA Change: V305M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102514
Gene: ENSMUSG00000028525
AA Change: V305M

DomainStartEndE-ValueType
HDc 170 345 2.35e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106904
AA Change: V461M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102517
Gene: ENSMUSG00000028525
AA Change: V461M

DomainStartEndE-ValueType
HDc 326 501 2.35e-5 SMART
low complexity region 608 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106908
AA Change: V523M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102521
Gene: ENSMUSG00000028525
AA Change: V523M

DomainStartEndE-ValueType
HDc 388 563 2.35e-5 SMART
low complexity region 670 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106911
AA Change: V538M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102524
Gene: ENSMUSG00000028525
AA Change: V538M

DomainStartEndE-ValueType
low complexity region 23 33 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
HDc 403 578 2.35e-5 SMART
low complexity region 685 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type IV, cyclic AMP (cAMP)-specific, cyclic nucleotide phosphodiesterase (PDE) family. The encoded protein regulates the cellular concentrations of cyclic nucleotides and thereby play a role in signal transduction. Altered activity of this protein has been associated with schizophrenia and bipolar affective disorder. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene produce significantly less TNF-alpha in response to lipopolysaccharide stimulation. One mutation resulted in brain and spinal cord vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
Atad5 T A 11: 80,120,720 N1307K possibly damaging Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 I190N probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mfsd4a G T 1: 132,067,663 T77N probably benign Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Ppme1 A T 7: 100,371,822 M1K probably null Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Rnf123 C A 9: 108,068,600 R329L probably benign Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slc12a4 G T 8: 105,945,223 A922D probably damaging Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Pde4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Pde4b APN 4 102506044 critical splice donor site probably null
IGL01146:Pde4b APN 4 102255263 missense possibly damaging 0.80
IGL01377:Pde4b APN 4 102487402 missense probably damaging 1.00
IGL01549:Pde4b APN 4 102605068 missense probably damaging 0.97
IGL01739:Pde4b APN 4 102601635 missense probably damaging 0.97
IGL01791:Pde4b APN 4 102590930 splice site probably benign
IGL02211:Pde4b APN 4 102590822 splice site probably benign
IGL02578:Pde4b APN 4 102255297 missense possibly damaging 0.94
IGL02878:Pde4b APN 4 102601639 missense probably damaging 1.00
PIT4458001:Pde4b UTSW 4 102602678 missense probably damaging 1.00
PIT4618001:Pde4b UTSW 4 102602812 missense probably benign 0.09
R0102:Pde4b UTSW 4 102590178 missense probably benign 0.15
R0230:Pde4b UTSW 4 102597510 missense probably benign 0.01
R0530:Pde4b UTSW 4 102602651 missense probably damaging 0.96
R0704:Pde4b UTSW 4 102487392 missense probably damaging 0.99
R1115:Pde4b UTSW 4 102542155 intron probably benign
R1450:Pde4b UTSW 4 102601635 missense probably damaging 0.97
R1457:Pde4b UTSW 4 102605176 missense probably damaging 0.99
R1568:Pde4b UTSW 4 102597699 missense probably damaging 1.00
R1740:Pde4b UTSW 4 102487351 missense probably damaging 1.00
R1784:Pde4b UTSW 4 102605260 missense probably benign 0.02
R1960:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R1961:Pde4b UTSW 4 102597460 missense probably damaging 0.99
R2033:Pde4b UTSW 4 102605295 missense probably benign 0.43
R2210:Pde4b UTSW 4 102597475 missense probably damaging 1.00
R2848:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R2936:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3195:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3196:Pde4b UTSW 4 102599643 missense probably damaging 0.99
R3695:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R3699:Pde4b UTSW 4 102601545 missense probably damaging 1.00
R4014:Pde4b UTSW 4 102555625 missense probably benign 0.00
R4627:Pde4b UTSW 4 102601605 missense probably damaging 1.00
R4852:Pde4b UTSW 4 102597770 missense probably damaging 1.00
R5055:Pde4b UTSW 4 102195114 intron probably benign
R5109:Pde4b UTSW 4 102601544 missense probably damaging 1.00
R5319:Pde4b UTSW 4 102421788 utr 3 prime probably benign
R5476:Pde4b UTSW 4 102602699 missense probably benign 0.00
R5576:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6019:Pde4b UTSW 4 102570769 missense possibly damaging 0.56
R6151:Pde4b UTSW 4 102601551 missense probably damaging 1.00
R6540:Pde4b UTSW 4 102601876 missense probably damaging 1.00
R6573:Pde4b UTSW 4 102430162 missense probably damaging 0.98
R6662:Pde4b UTSW 4 102601898 missense possibly damaging 0.82
R6751:Pde4b UTSW 4 102602671 missense probably damaging 0.98
R7066:Pde4b UTSW 4 102602806 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATGGTAAGATGCCAGCCTG -3'
(R):5'- GAGCTTTGAGGACCAATATTCAC -3'

Sequencing Primer
(F):5'- GCCAGCCTGCATCCCTTG -3'
(R):5'- GACACTGCAACTCAATTTTAGAAC -3'
Posted On2019-05-15