Incidental Mutation 'R7092:Slc12a4'
ID550292
Institutional Source Beutler Lab
Gene Symbol Slc12a4
Ensembl Gene ENSMUSG00000017765
Gene Namesolute carrier family 12, member 4
SynonymsKCC1, K-Cl Co-transporter-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7092 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105943590-105966097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105945223 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 922 (A922D)
Ref Sequence ENSEMBL: ENSMUSP00000034370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
Predicted Effect probably damaging
Transcript: ENSMUST00000034370
AA Change: A922D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765
AA Change: A922D

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038896
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116429
AA Change: A920D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765
AA Change: A920D

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
Atad5 T A 11: 80,120,720 N1307K possibly damaging Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 I190N probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mfsd4a G T 1: 132,067,663 T77N probably benign Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pde4b G A 4: 102,601,851 V523M probably damaging Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Ppme1 A T 7: 100,371,822 M1K probably null Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Rnf123 C A 9: 108,068,600 R329L probably benign Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Slc12a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Slc12a4 APN 8 105944089 missense probably damaging 1.00
IGL01637:Slc12a4 APN 8 105960707 missense possibly damaging 0.72
IGL01736:Slc12a4 APN 8 105945843 critical splice donor site probably null
IGL01804:Slc12a4 APN 8 105944401 missense probably damaging 1.00
IGL02000:Slc12a4 APN 8 105945232 missense probably damaging 1.00
IGL02526:Slc12a4 APN 8 105949806 missense possibly damaging 0.90
IGL03371:Slc12a4 APN 8 105950505 missense probably null 0.99
IGL03385:Slc12a4 APN 8 105950864 unclassified probably benign
PIT4810001:Slc12a4 UTSW 8 105951596 missense probably benign 0.00
R0033:Slc12a4 UTSW 8 105947479 splice site probably benign
R0200:Slc12a4 UTSW 8 105951617 missense probably benign 0.09
R0201:Slc12a4 UTSW 8 105945350 missense possibly damaging 0.79
R0270:Slc12a4 UTSW 8 105945389 missense probably benign 0.10
R0389:Slc12a4 UTSW 8 105951967 missense probably benign 0.00
R0432:Slc12a4 UTSW 8 105959488 missense probably damaging 1.00
R0751:Slc12a4 UTSW 8 105951900 missense probably damaging 1.00
R1717:Slc12a4 UTSW 8 105947571 unclassified probably null
R1792:Slc12a4 UTSW 8 105951843 missense possibly damaging 0.91
R1940:Slc12a4 UTSW 8 105946037 missense probably benign 0.29
R3115:Slc12a4 UTSW 8 105959459 missense probably damaging 1.00
R4898:Slc12a4 UTSW 8 105944609 missense probably damaging 1.00
R5182:Slc12a4 UTSW 8 105944606 missense probably damaging 1.00
R5220:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R5283:Slc12a4 UTSW 8 105950694 critical splice donor site probably null
R5367:Slc12a4 UTSW 8 105951634 missense probably damaging 0.99
R5610:Slc12a4 UTSW 8 105950213 missense possibly damaging 0.87
R5921:Slc12a4 UTSW 8 105945244 critical splice acceptor site probably null
R6060:Slc12a4 UTSW 8 105945706 missense probably damaging 1.00
R6182:Slc12a4 UTSW 8 105947899 missense probably damaging 1.00
R6722:Slc12a4 UTSW 8 105944250 intron probably null
R6800:Slc12a4 UTSW 8 105949739 missense probably damaging 1.00
R6956:Slc12a4 UTSW 8 105953852 missense probably damaging 1.00
R7032:Slc12a4 UTSW 8 105949233 missense probably damaging 1.00
R7229:Slc12a4 UTSW 8 105946737 missense probably benign 0.05
R7243:Slc12a4 UTSW 8 105953920 missense probably damaging 1.00
R7323:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7325:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7327:Slc12a4 UTSW 8 105955715 missense probably damaging 1.00
R7426:Slc12a4 UTSW 8 105950836 missense probably benign 0.00
R7569:Slc12a4 UTSW 8 105945847 missense probably damaging 1.00
X0019:Slc12a4 UTSW 8 105944352 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTTCTTTGTTAAAGACAGGCTGG -3'
(R):5'- AGGATCTGGCCATCTTCCTG -3'

Sequencing Primer
(F):5'- GTAGACTAGGCTAGCCTTGAACTC -3'
(R):5'- TGTATCACCTCCGCCTGGAAG -3'
Posted On2019-05-15