Incidental Mutation 'R7092:Atad5'
ID550306
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene NameATPase family, AAA domain containing 5
SynonymsLOC237877, C130052G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7092 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80089400-80135794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80120720 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1307 (N1307K)
Ref Sequence ENSEMBL: ENSMUSP00000017694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017694
AA Change: N1307K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: N1307K

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108239
AA Change: N1304K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: N1304K

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 I190N probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mfsd4a G T 1: 132,067,663 T77N probably benign Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pde4b G A 4: 102,601,851 V523M probably damaging Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Ppme1 A T 7: 100,371,822 M1K probably null Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Rnf123 C A 9: 108,068,600 R329L probably benign Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slc12a4 G T 8: 105,945,223 A922D probably damaging Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80132858 missense probably benign 0.22
IGL00916:Atad5 APN 11 80119000 missense probably damaging 1.00
IGL01348:Atad5 APN 11 80095564 missense probably benign 0.00
IGL01601:Atad5 APN 11 80095517 missense probably benign 0.45
IGL01916:Atad5 APN 11 80112839 critical splice donor site probably null
IGL02028:Atad5 APN 11 80134110 missense probably benign 0.20
IGL02095:Atad5 APN 11 80094707 missense probably benign 0.24
IGL02142:Atad5 APN 11 80094197 missense probably benign 0.00
IGL02206:Atad5 APN 11 80094183 missense probably damaging 1.00
IGL02385:Atad5 APN 11 80094627 missense probably benign 0.04
IGL02858:Atad5 APN 11 80089775 missense probably damaging 1.00
IGL02962:Atad5 APN 11 80108579 missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80111567 missense probably benign 0.04
R0040:Atad5 UTSW 11 80098014 missense probably benign
R0157:Atad5 UTSW 11 80089817 missense possibly damaging 0.74
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0211:Atad5 UTSW 11 80095647 missense probably benign 0.00
R0319:Atad5 UTSW 11 80120790 splice site probably benign
R0401:Atad5 UTSW 11 80120699 missense probably benign 0.11
R0426:Atad5 UTSW 11 80112832 missense probably benign 0.14
R0452:Atad5 UTSW 11 80106421 missense probably damaging 0.98
R0496:Atad5 UTSW 11 80100356 missense probably benign 0.08
R1691:Atad5 UTSW 11 80095532 missense probably benign 0.00
R1812:Atad5 UTSW 11 80133047 missense probably damaging 0.98
R2070:Atad5 UTSW 11 80098052 splice site probably null
R2071:Atad5 UTSW 11 80098052 splice site probably null
R2153:Atad5 UTSW 11 80106377 missense probably benign 0.04
R2415:Atad5 UTSW 11 80094251 missense probably damaging 1.00
R3917:Atad5 UTSW 11 80103294 missense probably null 0.97
R4025:Atad5 UTSW 11 80120686 missense probably damaging 1.00
R4464:Atad5 UTSW 11 80100311 splice site probably null
R4561:Atad5 UTSW 11 80095889 missense probably benign 0.01
R4579:Atad5 UTSW 11 80095191 missense probably damaging 1.00
R4844:Atad5 UTSW 11 80114311 splice site probably null
R4853:Atad5 UTSW 11 80095272 missense probably damaging 1.00
R4873:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R4875:Atad5 UTSW 11 80120689 missense probably damaging 1.00
R5054:Atad5 UTSW 11 80094676 missense probably benign 0.10
R5226:Atad5 UTSW 11 80095062 missense probably damaging 0.99
R5397:Atad5 UTSW 11 80111493 missense probably damaging 1.00
R5449:Atad5 UTSW 11 80124108 missense probably damaging 1.00
R5571:Atad5 UTSW 11 80111556 missense probably benign 0.05
R5575:Atad5 UTSW 11 80100323 missense probably benign 0.02
R5857:Atad5 UTSW 11 80131329 missense probably benign 0.06
R5927:Atad5 UTSW 11 80127285 missense probably damaging 1.00
R5928:Atad5 UTSW 11 80094177 missense probably damaging 1.00
R5949:Atad5 UTSW 11 80096009 nonsense probably null
R6102:Atad5 UTSW 11 80111572 critical splice donor site probably null
R6254:Atad5 UTSW 11 80127389 missense probably damaging 0.96
R6562:Atad5 UTSW 11 80133206 missense probably benign 0.26
R6744:Atad5 UTSW 11 80134032 missense probably benign 0.00
R7202:Atad5 UTSW 11 80089775 missense probably damaging 1.00
R7345:Atad5 UTSW 11 80096006 missense probably damaging 1.00
R7352:Atad5 UTSW 11 80103343 critical splice donor site probably null
R7358:Atad5 UTSW 11 80133036 missense probably benign 0.32
R7420:Atad5 UTSW 11 80095862 missense probably benign 0.06
R7453:Atad5 UTSW 11 80119143 critical splice donor site probably null
X0024:Atad5 UTSW 11 80132783 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAACTACCCAGTGATTAGTTAGCG -3'
(R):5'- TATCTGCTGAGCTCTCTCCAGG -3'

Sequencing Primer
(F):5'- CTCTGAGTTCAAGGCCAGTTTACAG -3'
(R):5'- GAGCTCTCTCCAGGCCATAC -3'
Posted On2019-05-15