Incidental Mutation 'R7096:Arhgef25'
ID550497
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene NameRho guanine nucleotide exchange factor (GEF) 25
SynonymsD10Ertd610e, 2410008H17Rik, GEFT
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R7096 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127182525-127190083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127184028 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 447 (Y447C)
Ref Sequence ENSEMBL: ENSMUSP00000019611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006] [ENSMUST00000222911]
Predicted Effect probably damaging
Transcript: ENSMUST00000019611
AA Change: Y447C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467
AA Change: Y447C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167353
AA Change: Y438C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467
AA Change: Y438C

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably damaging
Transcript: ENSMUST00000218654
AA Change: Y408C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect probably damaging
Transcript: ENSMUST00000222006
AA Change: Y447C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,933,870 M383R probably damaging Het
Acd T A 8: 105,698,489 E366V possibly damaging Het
Acvr2b T A 9: 119,428,189 probably null Het
Alg10b C T 15: 90,227,361 T136I probably benign Het
Ankrd42 T A 7: 92,591,832 K440* probably null Het
Apc T A 18: 34,315,957 S1969T probably damaging Het
AW146154 G A 7: 41,481,443 A83V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Barhl1 T G 2: 28,909,714 I300L probably benign Het
Brd1 C A 15: 88,713,935 R536L probably damaging Het
Brms1 T A 19: 5,046,680 I130N probably damaging Het
Ccdc68 A G 18: 69,940,170 H63R probably damaging Het
Ccl28 A G 13: 119,650,893 I74V probably benign Het
Cd300ld T A 11: 114,987,495 I64F possibly damaging Het
Cdkl2 G A 5: 92,033,184 Q199* probably null Het
Cdkn2c C T 4: 109,661,358 R133Q probably benign Het
Coq2 A G 5: 100,663,720 probably benign Het
Coq6 T C 12: 84,361,821 probably null Het
Csmd2 C T 4: 128,462,726 S1608L Het
Cyp11b2 T A 15: 74,855,988 R82W probably damaging Het
Cyp2d10 T C 15: 82,405,261 T217A probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dnah7a T C 1: 53,483,440 I2880V possibly damaging Het
Dync1h1 C A 12: 110,657,078 T3595K probably damaging Het
Ecscr T A 18: 35,715,425 E183V probably damaging Het
Elovl6 A G 3: 129,605,106 N52S probably benign Het
Eps8l1 G T 7: 4,474,191 A455S probably benign Het
Gpat2 A G 2: 127,428,289 N74S probably benign Het
Gstk1 C A 6: 42,249,473 T172K probably damaging Het
Gtf3c1 T C 7: 125,696,559 probably null Het
Gucy2c T C 6: 136,728,341 D532G probably benign Het
Hoxc12 T A 15: 102,937,038 N62K possibly damaging Het
Hsdl1 C A 8: 119,566,325 A124S possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Lcat C T 8: 105,939,677 M404I possibly damaging Het
Ldhb A G 6: 142,501,373 F72L probably benign Het
Map10 T C 8: 125,671,923 L685P probably damaging Het
Me2 A G 18: 73,794,890 V174A probably benign Het
Med13l C A 5: 118,721,926 Q328K possibly damaging Het
Mta2 A T 19: 8,947,775 I336F probably damaging Het
Mterf1a A T 5: 3,891,769 I33N probably damaging Het
Myo15b T A 11: 115,891,498 probably null Het
Myof C A 19: 37,936,200 G1215V probably damaging Het
Nlgn2 G A 11: 69,825,690 T675M probably damaging Het
Olfr385 T A 11: 73,589,637 M34L probably benign Het
Olfr485 C A 7: 108,159,641 M77I probably benign Het
Olfr768 T C 10: 129,093,846 I43V probably damaging Het
Padi3 T C 4: 140,800,124 D122G probably damaging Het
Pcnx3 G A 19: 5,672,615 R1350C probably damaging Het
Pdzrn4 C A 15: 92,397,503 Q197K probably benign Het
Pitpnm2 C T 5: 124,129,261 G639S possibly damaging Het
Piwil4 T A 9: 14,736,816 K156* probably null Het
Pkmyt1 T A 17: 23,734,113 H214Q probably damaging Het
Pnpt1 G A 11: 29,154,867 R597Q probably benign Het
Poteg C A 8: 27,473,567 A344E probably benign Het
Rad21l A G 2: 151,667,920 M87T probably benign Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Rap1gap2 C A 11: 74,392,231 R681L probably damaging Het
Rimbp2 C A 5: 128,774,269 R871L probably damaging Het
Rnf135 T C 11: 80,189,225 V114A probably benign Het
Skiv2l T A 17: 34,841,470 H849L probably benign Het
Snai2 A G 16: 14,707,164 H178R possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Taar1 A T 10: 23,920,911 E169V possibly damaging Het
Tdrd12 G T 7: 35,487,589 D625E Het
Tlr6 A G 5: 64,953,776 V596A probably benign Het
Trak2 T G 1: 58,903,590 N886H probably damaging Het
Tsga10 T A 1: 37,840,614 D32V probably damaging Het
Vmn1r214 A G 13: 23,035,026 D230G probably damaging Het
Vmn2r108 A G 17: 20,462,500 L814S probably damaging Het
Zbbx T C 3: 75,081,737 D353G probably benign Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127184170 missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127185591 missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127185925 missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127189554 missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0106:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127184453 missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127183697 missense probably null 0.03
R0676:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127185289 missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127185864 missense probably damaging 1.00
R2055:Arhgef25 UTSW 10 127185135 missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127189521 missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127187194 missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127189736 missense probably benign
R3837:Arhgef25 UTSW 10 127189736 missense probably benign
R3838:Arhgef25 UTSW 10 127189736 missense probably benign
R3839:Arhgef25 UTSW 10 127189736 missense probably benign
R3950:Arhgef25 UTSW 10 127185144 missense probably damaging 1.00
R3980:Arhgef25 UTSW 10 127187220 missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127182933 missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127185603 missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127187274 missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127185882 missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127184101 missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127183772 missense possibly damaging 0.92
R7482:Arhgef25 UTSW 10 127185671 missense probably damaging 1.00
X0018:Arhgef25 UTSW 10 127183699 missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127183257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCACCTGGATTGGCAATC -3'
(R):5'- CGGTTCCAGGGAAAACTGAC -3'

Sequencing Primer
(F):5'- GAGACAGCTCTCAGATTCTGC -3'
(R):5'- GTTCCAGGGAAAACTGACTGCTC -3'
Posted On2019-05-15