Incidental Mutation 'R0595:Tas2r138'
ID55057
Institutional Source Beutler Lab
Gene Symbol Tas2r138
Ensembl Gene ENSMUSG00000058250
Gene Nametaste receptor, type 2, member 138
Synonymsmt2r31, T2R138, Tas2r38
MMRRC Submission 038785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0595 (G1)
Quality Score200
Status Validated
Chromosome6
Chromosomal Location40612315-40613310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40612865 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 149 (L149P)
Ref Sequence ENSEMBL: ENSMUSP00000075876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076565]
Predicted Effect probably damaging
Transcript: ENSMUST00000076565
AA Change: L149P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: L149P

DomainStartEndE-ValueType
Pfam:TAS2R 11 315 3.8e-64 PFAM
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Tas2r138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Tas2r138 APN 6 40612586 missense probably benign 0.07
IGL01468:Tas2r138 APN 6 40612476 missense probably benign 0.22
IGL02626:Tas2r138 APN 6 40612715 missense possibly damaging 0.61
IGL03008:Tas2r138 APN 6 40613182 missense probably damaging 1.00
R2845:Tas2r138 UTSW 6 40612767 missense probably benign 0.09
R2975:Tas2r138 UTSW 6 40613264 missense probably benign 0.00
R4202:Tas2r138 UTSW 6 40612476 missense possibly damaging 0.95
R4923:Tas2r138 UTSW 6 40612886 missense possibly damaging 0.82
R5526:Tas2r138 UTSW 6 40612980 missense probably benign 0.00
R6647:Tas2r138 UTSW 6 40612799 missense possibly damaging 0.91
R6869:Tas2r138 UTSW 6 40612421 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAAGCTGCCATCATCCCTATAC -3'
(R):5'- TGCTTCCAGCAGATGAAAGACCC -3'

Sequencing Primer
(F):5'- TTGTGCCATAGCATCAGTAAGG -3'
(R):5'- GATGAAAGACCCACTGAGCC -3'
Posted On2013-07-11