Incidental Mutation 'R7098:Tgfb2'
ID550608
Institutional Source Beutler Lab
Gene Symbol Tgfb2
Ensembl Gene ENSMUSG00000039239
Gene Nametransforming growth factor, beta 2
SynonymsTgfb-2, Tgf-beta2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7098 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location186622792-186705989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 186630637 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 330 (R330H)
Ref Sequence ENSEMBL: ENSMUSP00000142149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000195201]
Predicted Effect probably damaging
Transcript: ENSMUST00000045288
AA Change: R302H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239
AA Change: R302H

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 20 284 1.1e-38 PFAM
TGFB 317 414 1.25e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195201
AA Change: R330H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239
AA Change: R330H

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 9 138 2.4e-9 PFAM
Pfam:TGFb_propeptide 152 311 1.4e-23 PFAM
TGFB 345 442 6.1e-40 SMART
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Apba2 T A 7: 64,736,948 V441D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Cc2d2a A T 5: 43,683,139 T161S probably benign Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Lrrc40 T A 3: 158,041,639 N129K probably benign Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Rap1gap C A 4: 137,716,082 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Sh3tc1 A T 5: 35,702,014 probably null Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Sult2a1 A T 7: 13,816,053 probably null Het
Thoc3 A G 13: 54,466,306 I168T probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Ttll5 A G 12: 85,917,673 probably null Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Tgfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Tgfb2 APN 1 186704587 missense probably benign 0.39
IGL01304:Tgfb2 APN 1 186625473 missense probably damaging 0.99
IGL03028:Tgfb2 APN 1 186630609 critical splice donor site probably null
concise UTSW 1 186625513 missense probably benign 0.21
PIT4486001:Tgfb2 UTSW 1 186690727 missense probably benign 0.04
R2017:Tgfb2 UTSW 1 186630765 nonsense probably null
R2880:Tgfb2 UTSW 1 186704555 missense probably damaging 1.00
R4182:Tgfb2 UTSW 1 186629025 missense possibly damaging 0.95
R4292:Tgfb2 UTSW 1 186632538 missense probably damaging 1.00
R4478:Tgfb2 UTSW 1 186632499 missense probably damaging 1.00
R4801:Tgfb2 UTSW 1 186628913 nonsense probably null
R4802:Tgfb2 UTSW 1 186628913 nonsense probably null
R5247:Tgfb2 UTSW 1 186649914 intron probably null
R5254:Tgfb2 UTSW 1 186704483 missense probably damaging 1.00
R5614:Tgfb2 UTSW 1 186625513 missense probably benign 0.21
R5988:Tgfb2 UTSW 1 186704581 missense probably benign 0.05
R6898:Tgfb2 UTSW 1 186632500 missense probably damaging 1.00
R6961:Tgfb2 UTSW 1 186649835 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGTTCTTACAAGAGCCAAAAGC -3'
(R):5'- GCCGTTTGTGACCATATACAGG -3'

Sequencing Primer
(F):5'- AAGCTCGACCGTCCTCTAC -3'
(R):5'- TGTGACCATATACAGGGGTGG -3'
Posted On2019-05-15