Incidental Mutation 'R7098:Lrrc40'
ID550619
Institutional Source Beutler Lab
Gene Symbol Lrrc40
Ensembl Gene ENSMUSG00000063052
Gene Nameleucine rich repeat containing 40
Synonyms2610040E16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7098 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location158036662-158068487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158041639 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 129 (N129K)
Ref Sequence ENSEMBL: ENSMUSP00000071956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072080] [ENSMUST00000121326] [ENSMUST00000150525] [ENSMUST00000156597] [ENSMUST00000200540]
Predicted Effect probably benign
Transcript: ENSMUST00000072080
AA Change: N129K

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071956
Gene: ENSMUSG00000063052
AA Change: N129K

DomainStartEndE-ValueType
LRR 81 100 7.11e1 SMART
LRR 104 126 6.13e-1 SMART
LRR 127 149 1.51e0 SMART
LRR_TYP 150 172 8.47e-4 SMART
LRR 173 195 3.52e-1 SMART
LRR_TYP 196 219 2.91e-2 SMART
LRR 242 261 9.15e0 SMART
LRR 265 287 1.01e2 SMART
LRR 288 310 1.86e1 SMART
LRR 311 334 2.32e-1 SMART
LRR 335 356 2.21e2 SMART
LRR 471 493 1.86e0 SMART
LRR 494 517 8.97e0 SMART
LRR 541 564 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121326
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123028
SMART Domains Protein: ENSMUSP00000121905
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 37 68 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131518
SMART Domains Protein: ENSMUSP00000121417
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 80 110 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150525
SMART Domains Protein: ENSMUSP00000116475
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 81 111 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156597
Predicted Effect probably benign
Transcript: ENSMUST00000200540
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Apba2 T A 7: 64,736,948 V441D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Cc2d2a A T 5: 43,683,139 T161S probably benign Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Tgfb2 C T 1: 186,630,637 R330H probably damaging Het
Thoc3 A G 13: 54,466,306 I168T probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Ttll5 A G 12: 85,917,673 probably null Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Lrrc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrc40 APN 3 158048450 missense probably damaging 1.00
IGL00501:Lrrc40 APN 3 158061282 missense probably damaging 0.96
IGL00727:Lrrc40 APN 3 158063871 critical splice donor site probably null
IGL01349:Lrrc40 APN 3 158058665 splice site probably benign
IGL02377:Lrrc40 APN 3 158036728 start codon destroyed probably null 1.00
IGL02490:Lrrc40 APN 3 158062699 missense probably damaging 1.00
IGL02657:Lrrc40 APN 3 158036773 missense probably damaging 1.00
IGL02879:Lrrc40 APN 3 158041665 intron probably benign
IGL02944:Lrrc40 APN 3 158041665 intron probably benign
IGL02954:Lrrc40 APN 3 158041665 intron probably benign
IGL02966:Lrrc40 APN 3 158041665 intron probably benign
IGL03004:Lrrc40 APN 3 158041665 intron probably benign
IGL03032:Lrrc40 APN 3 158041665 intron probably benign
IGL03112:Lrrc40 APN 3 158041665 intron probably benign
IGL03163:Lrrc40 APN 3 158041587 missense possibly damaging 0.82
I2288:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
R0266:Lrrc40 UTSW 3 158041661 critical splice donor site probably null
R0355:Lrrc40 UTSW 3 158040471 missense probably damaging 0.99
R0457:Lrrc40 UTSW 3 158054564 intron probably null
R0968:Lrrc40 UTSW 3 158036789 missense probably damaging 1.00
R1799:Lrrc40 UTSW 3 158036804 missense probably benign 0.38
R1962:Lrrc40 UTSW 3 158040449 missense probably benign 0.01
R4614:Lrrc40 UTSW 3 158054634 missense probably damaging 1.00
R4825:Lrrc40 UTSW 3 158061330 nonsense probably null
R4857:Lrrc40 UTSW 3 158066229 utr 3 prime probably benign
R4947:Lrrc40 UTSW 3 158063835 missense probably benign 0.00
R5148:Lrrc40 UTSW 3 158054569 splice site probably null
R5673:Lrrc40 UTSW 3 158048398 splice site probably null
R6354:Lrrc40 UTSW 3 158061264 nonsense probably null
R6382:Lrrc40 UTSW 3 158058696 missense probably damaging 0.98
R6713:Lrrc40 UTSW 3 158063713 missense probably benign 0.00
R7081:Lrrc40 UTSW 3 158036805 missense probably damaging 0.98
V1662:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTGGACAGCAGTTTGGTC -3'
(R):5'- CTCTGGGATGATGTAAAGATCTGG -3'

Sequencing Primer
(F):5'- CTGGACAGCAGTTTGGTCAATATAC -3'
(R):5'- GTAAAGATCTGGTCTTGTTTTCTCC -3'
Posted On2019-05-15