Incidental Mutation 'R7098:Cc2d2a'
ID550626
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R7098 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43683139 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 161 (T161S)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect probably benign
Transcript: ENSMUST00000048150
AA Change: T161S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: T161S

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
AA Change: T112S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: T112S

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Apba2 T A 7: 64,736,948 V441D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Lrrc40 T A 3: 158,041,639 N129K probably benign Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Rap1gap C A 4: 137,716,082 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Sh3tc1 A T 5: 35,702,014 probably null Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Sult2a1 A T 7: 13,816,053 probably null Het
Tgfb2 C T 1: 186,630,637 R330H probably damaging Het
Thoc3 A G 13: 54,466,306 I168T probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Ttll5 A G 12: 85,917,673 probably null Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAGGTCAACAATCTGGTC -3'
(R):5'- ATCTCACCTCCAGGACTTTAAAAG -3'

Sequencing Primer
(F):5'- GAGGTCAACAATCTGGTCTAGACTC -3'
(R):5'- CCTCCAGGACTTTAAAAGTAGAAATC -3'
Posted On2019-05-15