Incidental Mutation 'R7099:Otud7a'
ID550704
Institutional Source Beutler Lab
Gene Symbol Otud7a
Ensembl Gene ENSMUSG00000033510
Gene NameOTU domain containing 7A
SynonymsCezanne 2 protein, Otud7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R7099 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location63444751-63759028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63757455 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 502 (E502G)
Ref Sequence ENSEMBL: ENSMUSP00000057282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058476] [ENSMUST00000177511] [ENSMUST00000177534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058476
AA Change: E502G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057282
Gene: ENSMUSG00000033510
AA Change: E502G

DomainStartEndE-ValueType
PDB:2L2D|A 11 82 4e-43 PDB
Pfam:OTU 207 371 1.5e-26 PFAM
low complexity region 478 510 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 559 581 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 730 777 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 865 872 N/A INTRINSIC
Pfam:zf-A20 888 912 4.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177511
AA Change: R61G
SMART Domains Protein: ENSMUSP00000134821
Gene: ENSMUSG00000033510
AA Change: R61G

DomainStartEndE-ValueType
transmembrane domain 36 55 N/A INTRINSIC
low complexity region 56 89 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000135559
Gene: ENSMUSG00000033510
AA Change: E508G

DomainStartEndE-ValueType
Pfam:UBA_4 28 66 2e-7 PFAM
Pfam:OTU 206 377 5.7e-32 PFAM
low complexity region 484 516 N/A INTRINSIC
low complexity region 533 553 N/A INTRINSIC
low complexity region 565 587 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinizing enzyme and possible tumor suppressor. The encoded protein acts on TNF receptor associated factor 6 (TRAF6) to control nuclear factor kappa B expression. However, this gene is downregulated by SNAIL1 in hepatocellular carcinoma cells, contributing to their progression and malignancy. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal spike wave discharge, decreased dendritic spine density, decreased prepulse inhibition, impaired coordination, decreased grip strength, decreased startle reflex, impaired ultrasonic vocalization and delayed tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik C T 16: 64,770,788 A26T probably benign Het
Adam29 A C 8: 55,871,404 L672V probably benign Het
Adgrf1 T C 17: 43,310,602 S577P probably benign Het
Ankar T C 1: 72,643,293 K1371R probably damaging Het
Arid5b T C 10: 68,098,179 D631G probably damaging Het
Brpf3 T C 17: 28,806,637 V228A probably benign Het
C3 T C 17: 57,206,276 D1457G probably benign Het
Calr4 A T 4: 109,242,229 N143I probably benign Het
Cobl T A 11: 12,296,540 H154L Het
Dennd1c A G 17: 57,067,915 probably null Het
Dnah8 A T 17: 30,704,724 D1222V possibly damaging Het
Errfi1 T C 4: 150,866,768 S218P probably benign Het
Fbxw27 G T 9: 109,770,155 T398N probably damaging Het
Fhod3 A G 18: 25,090,162 D855G probably benign Het
Flii A G 11: 60,720,655 V410A probably benign Het
Fsip2 C A 2: 82,987,624 P4567Q probably benign Het
Fxyd1 T G 7: 31,053,033 Q66H probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gramd3 C T 18: 56,491,945 T370I probably benign Het
Kdr A G 5: 75,944,333 V1079A probably damaging Het
Lmx1a G A 1: 167,830,546 G166D probably damaging Het
Lrrfip2 A G 9: 111,173,108 R92G probably benign Het
Map1a T A 2: 121,300,517 S605T probably benign Het
Megf8 A T 7: 25,346,520 D1496V probably damaging Het
Mgam T C 6: 40,661,716 V461A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nav3 T C 10: 109,703,334 T2069A probably benign Het
Ndst1 A G 18: 60,695,500 F661L possibly damaging Het
Neu3 G A 7: 99,813,820 T232M possibly damaging Het
Nf1 T C 11: 79,570,330 S741P probably benign Het
Nr5a1 G T 2: 38,694,136 L424M probably damaging Het
Nuf2 G A 1: 169,506,072 T345M probably benign Het
Olfr1301 A T 2: 111,755,076 T276S probably benign Het
Olfr1426 A G 19: 12,088,166 F209L possibly damaging Het
Olfr212 T A 6: 116,516,760 *328R probably null Het
Olfr952 G A 9: 39,426,303 T256I probably benign Het
Otulin A G 15: 27,608,746 L237S probably damaging Het
Pias1 A G 9: 62,881,145 M79T Het
Prom2 T C 2: 127,539,778 E206G probably benign Het
Scarb1 A T 5: 125,304,350 N43K probably damaging Het
Sdad1 A G 5: 92,293,973 V365A possibly damaging Het
Sdk2 T C 11: 113,834,905 T1173A probably damaging Het
Sidt1 A G 16: 44,243,497 S803P probably damaging Het
Slc45a1 A T 4: 150,629,573 D738E probably benign Het
Slc4a7 T A 14: 14,733,750 H53Q probably damaging Het
Spata22 T C 11: 73,340,399 F160L probably benign Het
Stag1 G A 9: 100,944,826 V949I probably benign Het
Syne1 T C 10: 5,123,744 S1200G probably benign Het
Tbc1d9 A G 8: 83,254,891 E729G probably damaging Het
Tcaf2 C T 6: 42,630,341 M226I probably benign Het
Tigd2 C A 6: 59,210,181 T11K probably damaging Het
Trappc9 A G 15: 72,693,619 V941A probably benign Het
Ugt2b37 A G 5: 87,240,989 M455T probably benign Het
Usp42 A T 5: 143,726,645 S95T probably damaging Het
Usp44 T C 10: 93,850,187 I488T possibly damaging Het
Vmn1r73 T C 7: 11,756,393 I46T probably damaging Het
Vmn2r34 A T 7: 7,672,541 I616N probably damaging Het
Zfp352 A G 4: 90,224,880 K419R probably benign Het
Zfp595 T A 13: 67,317,647 H187L probably damaging Het
Zfp804b A T 5: 6,772,161 S301T probably benign Het
Zzef1 T C 11: 72,872,649 V1374A possibly damaging Het
Other mutations in Otud7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:Otud7a UTSW 7 63735801 missense probably benign 0.32
R0241:Otud7a UTSW 7 63697244 splice site probably benign
R0576:Otud7a UTSW 7 63685518 missense possibly damaging 0.93
R0594:Otud7a UTSW 7 63727472 nonsense probably null
R0611:Otud7a UTSW 7 63735890 missense possibly damaging 0.84
R1473:Otud7a UTSW 7 63754629 splice site probably benign
R1519:Otud7a UTSW 7 63758643 missense probably damaging 1.00
R1694:Otud7a UTSW 7 63733710 missense probably damaging 1.00
R1941:Otud7a UTSW 7 63729826 nonsense probably null
R1952:Otud7a UTSW 7 63650876 missense probably damaging 0.96
R2199:Otud7a UTSW 7 63757656 missense possibly damaging 0.53
R2404:Otud7a UTSW 7 63697151 missense probably benign 0.20
R4238:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4239:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4294:Otud7a UTSW 7 63697191 missense probably damaging 0.99
R4512:Otud7a UTSW 7 63729877 missense probably benign 0.32
R4748:Otud7a UTSW 7 63735915 missense possibly damaging 0.73
R4815:Otud7a UTSW 7 63729910 critical splice donor site probably null
R4942:Otud7a UTSW 7 63757423 missense probably damaging 0.99
R5249:Otud7a UTSW 7 63757433 missense possibly damaging 0.53
R5332:Otud7a UTSW 7 63735826 missense probably damaging 0.98
R5438:Otud7a UTSW 7 63757459 missense unknown
R6185:Otud7a UTSW 7 63758385 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTTCTTGGGGCCTACAC -3'
(R):5'- TGCTGTACTTCCAGGCATCG -3'

Sequencing Primer
(F):5'- CAGCTTTTCTGTATGTAACCTTCC -3'
(R):5'- GCGCGACTTGGACTTTTTC -3'
Posted On2019-05-15