Incidental Mutation 'R7099:C3'
ID550734
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7099 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57206276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1457 (D1457G)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect probably benign
Transcript: ENSMUST00000024988
AA Change: D1457G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: D1457G

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik C T 16: 64,770,788 A26T probably benign Het
Adam29 A C 8: 55,871,404 L672V probably benign Het
Adgrf1 T C 17: 43,310,602 S577P probably benign Het
Ankar T C 1: 72,643,293 K1371R probably damaging Het
Arid5b T C 10: 68,098,179 D631G probably damaging Het
Brpf3 T C 17: 28,806,637 V228A probably benign Het
Calr4 A T 4: 109,242,229 N143I probably benign Het
Cobl T A 11: 12,296,540 H154L Het
Dennd1c A G 17: 57,067,915 probably null Het
Dnah8 A T 17: 30,704,724 D1222V possibly damaging Het
Errfi1 T C 4: 150,866,768 S218P probably benign Het
Fbxw27 G T 9: 109,770,155 T398N probably damaging Het
Fhod3 A G 18: 25,090,162 D855G probably benign Het
Flii A G 11: 60,720,655 V410A probably benign Het
Fsip2 C A 2: 82,987,624 P4567Q probably benign Het
Fxyd1 T G 7: 31,053,033 Q66H probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gramd3 C T 18: 56,491,945 T370I probably benign Het
Kdr A G 5: 75,944,333 V1079A probably damaging Het
Lmx1a G A 1: 167,830,546 G166D probably damaging Het
Lrrfip2 A G 9: 111,173,108 R92G probably benign Het
Map1a T A 2: 121,300,517 S605T probably benign Het
Megf8 A T 7: 25,346,520 D1496V probably damaging Het
Mgam T C 6: 40,661,716 V461A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nav3 T C 10: 109,703,334 T2069A probably benign Het
Ndst1 A G 18: 60,695,500 F661L possibly damaging Het
Neu3 G A 7: 99,813,820 T232M possibly damaging Het
Nf1 T C 11: 79,570,330 S741P probably benign Het
Nr5a1 G T 2: 38,694,136 L424M probably damaging Het
Nuf2 G A 1: 169,506,072 T345M probably benign Het
Olfr1301 A T 2: 111,755,076 T276S probably benign Het
Olfr1426 A G 19: 12,088,166 F209L possibly damaging Het
Olfr212 T A 6: 116,516,760 *328R probably null Het
Olfr952 G A 9: 39,426,303 T256I probably benign Het
Otud7a A G 7: 63,757,455 E502G possibly damaging Het
Otulin A G 15: 27,608,746 L237S probably damaging Het
Pias1 A G 9: 62,881,145 M79T Het
Prom2 T C 2: 127,539,778 E206G probably benign Het
Scarb1 A T 5: 125,304,350 N43K probably damaging Het
Sdad1 A G 5: 92,293,973 V365A possibly damaging Het
Sdk2 T C 11: 113,834,905 T1173A probably damaging Het
Sidt1 A G 16: 44,243,497 S803P probably damaging Het
Slc45a1 A T 4: 150,629,573 D738E probably benign Het
Slc4a7 T A 14: 14,733,750 H53Q probably damaging Het
Spata22 T C 11: 73,340,399 F160L probably benign Het
Stag1 G A 9: 100,944,826 V949I probably benign Het
Syne1 T C 10: 5,123,744 S1200G probably benign Het
Tbc1d9 A G 8: 83,254,891 E729G probably damaging Het
Tcaf2 C T 6: 42,630,341 M226I probably benign Het
Tigd2 C A 6: 59,210,181 T11K probably damaging Het
Trappc9 A G 15: 72,693,619 V941A probably benign Het
Ugt2b37 A G 5: 87,240,989 M455T probably benign Het
Usp42 A T 5: 143,726,645 S95T probably damaging Het
Usp44 T C 10: 93,850,187 I488T possibly damaging Het
Vmn1r73 T C 7: 11,756,393 I46T probably damaging Het
Vmn2r34 A T 7: 7,672,541 I616N probably damaging Het
Zfp352 A G 4: 90,224,880 K419R probably benign Het
Zfp595 T A 13: 67,317,647 H187L probably damaging Het
Zfp804b A T 5: 6,772,161 S301T probably benign Het
Zzef1 T C 11: 72,872,649 V1374A possibly damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 intron probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 intron probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 intron probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTATGGATGCCTCAGGATC -3'
(R):5'- GGAAACAGTCTGGCTCCAAG -3'

Sequencing Primer
(F):5'- CTCAGGATCCTCTGGTGCTATTAAAG -3'
(R):5'- GCTCCAAGCACGGTAGAAAAG -3'
Posted On2019-05-15