Incidental Mutation 'R7100:Mpl'
ID550755
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Namemyeloproliferative leukemia virus oncogene
SynonymsTPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7100 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118442415-118457513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118457410 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 21 (A21E)
Ref Sequence ENSEMBL: ENSMUSP00000006556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
Predicted Effect
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: A21E

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102671
AA Change: A21E

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: A21E

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106375
AA Change: A14E

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: A14E

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389
AA Change: A20E

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,552,395 E89G probably damaging Het
Adgrv1 A T 13: 81,270,897 V5993E probably damaging Het
Amdhd1 T C 10: 93,537,074 probably null Het
Amph T C 13: 19,149,841 *691Q probably null Het
Ankrd55 A G 13: 112,356,110 K272E probably benign Het
Arhgef10l C T 4: 140,516,815 V838I possibly damaging Het
Arl2 C A 19: 6,134,744 V160F probably benign Het
BC067074 T A 13: 113,318,967 F516I Het
Catsperb T C 12: 101,446,038 V128A possibly damaging Het
Cdk11b T A 4: 155,625,593 L17H probably damaging Het
Cpsf1 A T 15: 76,596,114 N1391K possibly damaging Het
Cpxm2 C T 7: 132,054,815 A573T probably benign Het
Daxx T C 17: 33,911,442 S144P probably damaging Het
Dpp3 T C 19: 4,918,041 D303G probably damaging Het
Fam126b T A 1: 58,534,494 T384S possibly damaging Het
Fam181a T A 12: 103,315,873 N12K probably damaging Het
Flg2 A T 3: 93,203,711 R1015S unknown Het
Fstl5 A G 3: 76,536,293 H315R probably benign Het
Fut4 A G 9: 14,751,393 S202P probably damaging Het
Gm5114 T C 7: 39,408,284 D637G possibly damaging Het
Gstcd G T 3: 133,084,943 T21K probably benign Het
Heca C T 10: 17,915,373 V312M probably benign Het
Herpud1 A G 8: 94,390,847 R144G probably damaging Het
Hrasls5 T A 19: 7,639,558 F313I unknown Het
Ino80 A G 2: 119,374,513 S1511P possibly damaging Het
Irf2bp2 T C 8: 126,591,733 T365A probably benign Het
Klk1 G A 7: 44,229,424 G214E probably damaging Het
Lama3 A T 18: 12,582,644 N1719I possibly damaging Het
Lmna A G 3: 88,484,990 I365T probably damaging Het
Lrp8 C A 4: 107,802,450 A13E possibly damaging Het
Ly75 A G 2: 60,306,434 L1483P probably benign Het
Mid1 A G X: 169,985,077 D407G probably benign Het
Mus81 C T 19: 5,484,211 G360S probably damaging Het
Nmt2 T A 2: 3,312,913 S250T probably benign Het
Nr1d1 C A 11: 98,771,334 R158L probably damaging Het
Pcgf6 G A 19: 47,050,714 P36S unknown Het
Pcnx2 G A 8: 125,759,114 A1915V probably benign Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Phf20l1 A G 15: 66,604,840 N262S probably benign Het
Ppp2r5d A G 17: 46,685,682 V355A probably benign Het
Rasa3 T C 8: 13,586,897 T395A probably benign Het
Rims1 T A 1: 22,346,473 I432F probably benign Het
Rnf123 C T 9: 108,056,639 C1080Y probably damaging Het
Serpina3g T C 12: 104,238,311 probably benign Het
Shank2 T A 7: 144,411,164 D836E possibly damaging Het
Slc24a5 A C 2: 125,080,671 S118R probably damaging Het
Smg1 G T 7: 118,184,520 H1048N unknown Het
Specc1l T G 10: 75,245,495 S242A probably benign Het
Tagap1 A T 17: 6,956,712 L195Q possibly damaging Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Trpc3 C A 3: 36,650,067 E580D probably benign Het
Ttn A T 2: 76,710,822 V33940E probably benign Het
Upp2 G T 2: 58,791,805 R318L probably benign Het
Vezt T A 10: 93,996,933 E205D probably benign Het
Vmn1r177 A G 7: 23,866,110 F114L probably benign Het
Vmn2r53 C A 7: 12,581,586 E769* probably null Het
Vnn3 T C 10: 23,865,942 Y382H probably damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0601:Mpl UTSW 4 118443536 missense probably benign 0.08
R0784:Mpl UTSW 4 118446406 missense possibly damaging 0.59
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1806:Mpl UTSW 4 118443532 missense possibly damaging 0.73
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5158:Mpl UTSW 4 118456684 missense probably damaging 0.98
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6450:Mpl UTSW 4 118448700 splice site probably null
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
R7095:Mpl UTSW 4 118444063 missense
R7173:Mpl UTSW 4 118448544 critical splice donor site probably null
R7177:Mpl UTSW 4 118448544 critical splice donor site probably null
R7512:Mpl UTSW 4 118448892 missense
Predicted Primers PCR Primer
(F):5'- GGCCAGCAAGAAGACATCTG -3'
(R):5'- TCTCCATTTGATTCACAGGCG -3'

Sequencing Primer
(F):5'- TCTGAGAACAGAGATGGTGAGTTG -3'
(R):5'- CACAGGCGAATATATACCTCTGTGTC -3'
Posted On2019-05-15