Incidental Mutation 'R7103:Amph'
ID551008
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Nameamphiphysin
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R7103 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location18948205-19150921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19149738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 656 (D656E)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
Predicted Effect probably benign
Transcript: ENSMUST00000003345
AA Change: D652E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: D652E

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200466
AA Change: D656E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: D656E

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19120606 missense probably damaging 1.00
IGL01866:Amph APN 13 19142002 missense probably damaging 1.00
IGL02157:Amph APN 13 19104231 missense possibly damaging 0.60
IGL02300:Amph APN 13 19086604 missense probably damaging 1.00
IGL02435:Amph APN 13 19139163 splice site probably benign
IGL03060:Amph APN 13 19094814 missense probably damaging 0.99
IGL03122:Amph APN 13 19102943 missense probably damaging 0.98
R0037:Amph UTSW 13 19100653 missense possibly damaging 0.90
R0646:Amph UTSW 13 19113116 missense possibly damaging 0.95
R0652:Amph UTSW 13 19086621 splice site probably null
R1005:Amph UTSW 13 19142028 missense probably damaging 0.97
R1006:Amph UTSW 13 19142028 missense probably damaging 0.97
R1199:Amph UTSW 13 19142028 missense probably damaging 0.97
R1200:Amph UTSW 13 19142028 missense probably damaging 0.97
R1201:Amph UTSW 13 19142028 missense probably damaging 0.97
R1333:Amph UTSW 13 19142028 missense probably damaging 0.97
R1334:Amph UTSW 13 19142028 missense probably damaging 0.97
R1335:Amph UTSW 13 19142028 missense probably damaging 0.97
R1337:Amph UTSW 13 19142028 missense probably damaging 0.97
R1338:Amph UTSW 13 19142028 missense probably damaging 0.97
R1384:Amph UTSW 13 19142028 missense probably damaging 0.97
R1397:Amph UTSW 13 19142028 missense probably damaging 0.97
R1501:Amph UTSW 13 19104291 nonsense probably null
R1528:Amph UTSW 13 19142028 missense probably damaging 0.97
R1822:Amph UTSW 13 18948455 missense probably damaging 0.98
R2004:Amph UTSW 13 19142028 missense probably damaging 0.97
R2006:Amph UTSW 13 19142028 missense probably damaging 0.97
R2061:Amph UTSW 13 19125035 nonsense probably null
R2111:Amph UTSW 13 19116266 splice site probably benign
R2329:Amph UTSW 13 19139350 missense probably benign
R2878:Amph UTSW 13 19104267 missense possibly damaging 0.95
R3121:Amph UTSW 13 19113146 nonsense probably null
R3548:Amph UTSW 13 19102959 missense probably damaging 1.00
R4059:Amph UTSW 13 19141998 missense probably damaging 1.00
R4369:Amph UTSW 13 19137700 missense probably benign 0.20
R4492:Amph UTSW 13 19149758 missense possibly damaging 0.76
R4855:Amph UTSW 13 19084208 missense probably damaging 1.00
R4937:Amph UTSW 13 19104345 missense probably damaging 1.00
R4965:Amph UTSW 13 19137699 missense probably benign 0.12
R5777:Amph UTSW 13 19046016 missense probably damaging 1.00
R5787:Amph UTSW 13 18948454 missense possibly damaging 0.75
R6091:Amph UTSW 13 19125123 missense probably benign 0.01
R7100:Amph UTSW 13 19149841 makesense probably null
V1662:Amph UTSW 13 19139370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTCAGGTAATGCTAACTCAATAGTCCG -3'
(R):5'- CCTCTGCATTCCGTGAATGG -3'

Sequencing Primer
(F):5'- TGAGGTCCCAGTACTAGCT -3'
(R):5'- CTGCATTCCGTGAATGGTTAAGAAC -3'
Posted On2019-05-15