Incidental Mutation 'R7105:Bdp1'
ID551129
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7105 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100070181 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 618 (P618S)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably damaging
Transcript: ENSMUST00000038104
AA Change: P618S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: P618S

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109379
AA Change: P618S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: P618S

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTACCCACATATAAGTTCAGGCAAC -3'
(R):5'- TCCTCAGTAAGCTTTAAGGAACTC -3'

Sequencing Primer
(F):5'- CAGTGGTAAATGCTTGCCCAG -3'
(R):5'- TTTTAAAGAGAGACTGAACAGA -3'
Posted On2019-05-15