Incidental Mutation 'R7105:Ubr5'
ID551136
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7105 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38008775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1065 (T1065A)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: T1065A

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: T1071A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000227143
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Piezo1 A G 8: 122,482,118 I2503T unknown Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCTGACCTTCCACTG -3'
(R):5'- CCTCCACCATTCCAGGTAAG -3'

Sequencing Primer
(F):5'- ATAAACAGTGTTTTAGTAGCAGAGG -3'
(R):5'- AGGGCTTTAAGTAAAGTTTCGTTC -3'
Posted On2019-05-15