Incidental Mutation 'R7107:Zc3h11a'
ID551214
Institutional Source Beutler Lab
Gene Symbol Zc3h11a
Ensembl Gene ENSMUSG00000116275
Gene Name
Synonyms1110003F06Rik, 5730454B08Rik, G630041M05Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R7107 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133619871-133661380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133638917 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000141255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195424]
Predicted Effect probably damaging
Transcript: ENSMUST00000027736
AA Change: T179A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275
AA Change: T179A

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179598
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186476
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191896
AA Change: T179A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976
AA Change: T179A

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195424
AA Change: T179A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976
AA Change: T179A

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Zc3h11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zc3h11a APN 1 133625862 missense probably benign
IGL01961:Zc3h11a APN 1 133627067 missense probably benign 0.12
IGL02005:Zc3h11a APN 1 133622142 missense probably benign
IGL02365:Zc3h11a APN 1 133637413 missense probably benign 0.02
IGL02454:Zc3h11a APN 1 133624516 missense probably benign 0.09
PIT4449001:Zc3h11a UTSW 1 133624611 missense probably benign 0.22
R0180:Zc3h11a UTSW 1 133621611 missense probably benign 0.11
R0965:Zc3h11a UTSW 1 133645803 missense possibly damaging 0.80
R1389:Zc3h11a UTSW 1 133633803 missense probably damaging 0.99
R1607:Zc3h11a UTSW 1 133624687 missense probably benign
R1639:Zc3h11a UTSW 1 133624708 missense probably benign 0.03
R1720:Zc3h11a UTSW 1 133621701 missense probably damaging 0.97
R1728:Zc3h11a UTSW 1 133622154 missense probably benign
R1728:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1729:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1739:Zc3h11a UTSW 1 133622154 missense probably benign
R1739:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1762:Zc3h11a UTSW 1 133622154 missense probably benign
R1762:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1783:Zc3h11a UTSW 1 133622154 missense probably benign
R1783:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1784:Zc3h11a UTSW 1 133622154 missense probably benign
R1784:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1785:Zc3h11a UTSW 1 133622154 missense probably benign
R1785:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R2508:Zc3h11a UTSW 1 133624783 missense probably benign 0.01
R4792:Zc3h11a UTSW 1 133640698 missense probably damaging 0.98
R4901:Zc3h11a UTSW 1 133624711 missense probably benign 0.00
R4932:Zc3h11a UTSW 1 133624612 missense probably benign 0.00
R5135:Zc3h11a UTSW 1 133633789 missense probably benign 0.00
R5186:Zc3h11a UTSW 1 133621674 missense probably damaging 0.99
R5357:Zc3h11a UTSW 1 133623042 missense probably damaging 1.00
R5438:Zc3h11a UTSW 1 133640647 missense probably damaging 1.00
R6149:Zc3h11a UTSW 1 133638875 nonsense probably null
R6268:Zc3h11a UTSW 1 133624557 missense probably benign 0.01
R6385:Zc3h11a UTSW 1 133637454 missense possibly damaging 0.82
R6847:Zc3h11a UTSW 1 133638962 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTACACATTCTACGAGCATAGC -3'
(R):5'- GCTCAGAAAACGTTCCCAGC -3'

Sequencing Primer
(F):5'- GCATATCTGCTAAAGCTTAGTGGC -3'
(R):5'- GTTCCCAGCCCCACACATC -3'
Posted On2019-05-15