Incidental Mutation 'R7107:Cep250'
ID551217
Institutional Source Beutler Lab
Gene Symbol Cep250
Ensembl Gene ENSMUSG00000038241
Gene Namecentrosomal protein 250
SynonymsCep2, Inmp, B230210E21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R7107 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155956458-155998900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155995394 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2319 (T2319A)
Ref Sequence ENSEMBL: ENSMUSP00000105248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]
Predicted Effect probably benign
Transcript: ENSMUST00000039994
AA Change: T2318A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: T2318A

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094421
AA Change: T2298A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: T2298A

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109619
AA Change: T2319A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: T2319A

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124812
Predicted Effect probably benign
Transcript: ENSMUST00000128683
SMART Domains Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
coiled coil region 2 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
Arap2 T A 5: 62,606,208 H1531L probably damaging Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Cep250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Cep250 APN 2 155991329 missense probably benign 0.00
IGL01077:Cep250 APN 2 155962134 missense probably damaging 1.00
IGL01084:Cep250 APN 2 155998393 missense probably benign 0.00
IGL01400:Cep250 APN 2 155998291 missense possibly damaging 0.78
IGL01570:Cep250 APN 2 155967663 splice site probably benign
IGL01583:Cep250 APN 2 155976149 missense probably damaging 0.99
IGL01590:Cep250 APN 2 155992317 missense possibly damaging 0.80
IGL01647:Cep250 APN 2 155983376 missense probably benign 0.02
IGL01959:Cep250 APN 2 155983359 missense possibly damaging 0.63
IGL02066:Cep250 APN 2 155976521 missense probably damaging 1.00
IGL02219:Cep250 APN 2 155991594 missense probably benign 0.26
IGL02322:Cep250 APN 2 155990328 missense probably damaging 1.00
IGL02728:Cep250 APN 2 155983278 unclassified probably benign
IGL02955:Cep250 APN 2 155975756 missense probably benign 0.01
IGL03369:Cep250 APN 2 155990271 missense probably benign 0.00
R0366:Cep250 UTSW 2 155988401 missense probably benign 0.00
R0403:Cep250 UTSW 2 155992349 missense probably damaging 0.99
R0441:Cep250 UTSW 2 155972004 missense possibly damaging 0.82
R0482:Cep250 UTSW 2 155964974 splice site probably benign
R0507:Cep250 UTSW 2 155992532 missense possibly damaging 0.60
R0614:Cep250 UTSW 2 155970097 nonsense probably null
R0855:Cep250 UTSW 2 155964111 missense probably damaging 1.00
R0973:Cep250 UTSW 2 155964289 splice site probably benign
R1137:Cep250 UTSW 2 155990840 missense probably benign 0.05
R1270:Cep250 UTSW 2 155990681 missense probably benign 0.01
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1703:Cep250 UTSW 2 155965546 missense probably benign 0.23
R1705:Cep250 UTSW 2 155963786 missense probably damaging 1.00
R1740:Cep250 UTSW 2 155973356 missense probably damaging 0.99
R1796:Cep250 UTSW 2 155992187 missense possibly damaging 0.88
R1897:Cep250 UTSW 2 155976095 missense probably damaging 1.00
R1900:Cep250 UTSW 2 155985374 critical splice donor site probably null
R1958:Cep250 UTSW 2 155976381 splice site probably null
R1974:Cep250 UTSW 2 155989504 missense probably damaging 0.96
R2015:Cep250 UTSW 2 155981453 missense probably damaging 0.96
R2033:Cep250 UTSW 2 155970892 missense probably damaging 0.99
R2224:Cep250 UTSW 2 155991817 missense possibly damaging 0.94
R2266:Cep250 UTSW 2 155976170 missense probably benign 0.13
R2278:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2332:Cep250 UTSW 2 155990607 missense probably damaging 1.00
R2364:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2366:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2367:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2385:Cep250 UTSW 2 155974341 missense probably damaging 1.00
R2830:Cep250 UTSW 2 155983316 missense probably benign 0.00
R2895:Cep250 UTSW 2 155992122 missense probably benign 0.00
R2965:Cep250 UTSW 2 155994878 missense probably benign 0.44
R2966:Cep250 UTSW 2 155994878 missense probably benign 0.44
R3016:Cep250 UTSW 2 155991288 missense probably damaging 1.00
R3052:Cep250 UTSW 2 155991048 missense probably damaging 0.99
R3424:Cep250 UTSW 2 155981461 missense probably benign 0.02
R3930:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4085:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4087:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4088:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4090:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4110:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4355:Cep250 UTSW 2 155991525 missense probably damaging 1.00
R4601:Cep250 UTSW 2 155962053 missense probably benign 0.10
R4721:Cep250 UTSW 2 155970199 missense probably damaging 1.00
R4995:Cep250 UTSW 2 155988316 missense probably damaging 1.00
R5053:Cep250 UTSW 2 155962928 missense possibly damaging 0.77
R5090:Cep250 UTSW 2 155976404 missense probably damaging 1.00
R5744:Cep250 UTSW 2 155981474 missense possibly damaging 0.60
R5775:Cep250 UTSW 2 155969374 missense possibly damaging 0.92
R5986:Cep250 UTSW 2 155979277 missense probably damaging 1.00
R6112:Cep250 UTSW 2 155994583 missense possibly damaging 0.95
R6152:Cep250 UTSW 2 155981438 missense possibly damaging 0.94
R6823:Cep250 UTSW 2 155981459 missense probably benign 0.02
R6859:Cep250 UTSW 2 155992526 missense probably benign 0.24
R6900:Cep250 UTSW 2 155996270 critical splice acceptor site probably null
R7131:Cep250 UTSW 2 155965077 missense probably damaging 1.00
X0061:Cep250 UTSW 2 155961985 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGGCATGAGAGCTAGCCTG -3'
(R):5'- TAGCCCTGAGAACACACTTACATAG -3'

Sequencing Primer
(F):5'- ATGAGAGCTAGCCTGCCTCC -3'
(R):5'- ATAGGTAAGTAGGACCCCCTTCTG -3'
Posted On2019-05-15