Incidental Mutation 'R7107:Arap2'
ID551227
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
SynonymsCentd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7107 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location62602445-62766159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62606208 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1531 (H1531L)
Ref Sequence ENSEMBL: ENSMUSP00000075924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623]
Predicted Effect probably damaging
Transcript: ENSMUST00000076623
AA Change: H1531L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: H1531L

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,183 R608* probably null Het
4922502D21Rik A G 6: 129,322,952 C188R probably damaging Het
Abca8b A G 11: 109,976,473 L253S probably damaging Het
Adgrv1 T C 13: 81,578,142 E588G probably benign Het
Ahcy G A 2: 155,068,973 A25V probably damaging Het
Ank2 A C 3: 127,003,982 L710R probably damaging Het
Ap1b1 A G 11: 5,039,558 T824A probably benign Het
B3gnt7 T C 1: 86,305,773 L247P probably damaging Het
Bcl6b A G 11: 70,226,570 C409R probably damaging Het
Bicdl1 T C 5: 115,670,170 H301R probably benign Het
Casc3 T A 11: 98,827,587 I491N possibly damaging Het
Ccdc92b T A 11: 74,630,061 L63Q probably damaging Het
Cep250 A G 2: 155,995,394 T2319A probably benign Het
Chd1 T C 17: 15,761,366 S1356P probably damaging Het
Chd8 A G 14: 52,212,672 S1542P probably benign Het
Cntnap4 A G 8: 112,815,488 D751G probably damaging Het
Cpsf4l G A 11: 113,702,489 R90C possibly damaging Het
Defa21 G A 8: 21,025,708 A41T probably damaging Het
Dennd4a G T 9: 64,894,399 L941F possibly damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dtx4 A T 19: 12,473,260 C529* probably null Het
Entpd3 A G 9: 120,560,599 Y317C probably damaging Het
Erp29 T A 5: 121,445,318 I182F possibly damaging Het
Fam161a A G 11: 23,023,452 R445G possibly damaging Het
Fam214b A T 4: 43,036,434 V99E probably benign Het
Fam76a T A 4: 132,903,921 M238L possibly damaging Het
Fn1 T C 1: 71,627,249 Y875C probably damaging Het
Gnb2 A G 5: 137,530,182 probably null Het
Hspg2 T C 4: 137,510,652 S229P probably damaging Het
Ighv6-6 A G 12: 114,434,970 S59P probably damaging Het
Itpkc C A 7: 27,228,277 A71S probably benign Het
Kcnk10 G A 12: 98,518,743 R45* probably null Het
Krcc1 A G 6: 71,284,214 S77G probably benign Het
Lelp1 G A 3: 92,135,514 T76I unknown Het
Lifr A T 15: 7,178,940 I600F possibly damaging Het
Lrrk1 T A 7: 66,287,443 D987V possibly damaging Het
Mfsd7a T A 5: 108,448,715 probably null Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo9a A G 9: 59,870,815 I1285V probably benign Het
Ndel1 T C 11: 68,822,648 D321G possibly damaging Het
Nlrp4b T C 7: 10,715,217 V449A probably damaging Het
Olfr1386 T A 11: 49,470,434 Y94* probably null Het
Olfr1495 A G 19: 13,769,161 E273G probably benign Het
Olfr195 A C 16: 59,148,916 D22A probably benign Het
Olfr458 T C 6: 42,460,554 N155S possibly damaging Het
Olfr639 A T 7: 104,012,282 L140Q probably benign Het
Osbpl1a G A 18: 12,841,253 R459* probably null Het
Pabpc1l A C 2: 164,042,479 T379P probably damaging Het
Pde2a A T 7: 101,421,968 Q15L probably benign Het
Pdk1 A G 2: 71,895,741 N331S probably benign Het
Pfdn1 A T 18: 36,451,466 probably null Het
Pnliprp1 T A 19: 58,729,150 L9H probably damaging Het
Prl7a2 A T 13: 27,659,093 D242E possibly damaging Het
Prmt9 T A 8: 77,568,251 I408N possibly damaging Het
Psme4 G A 11: 30,848,105 R1366H probably benign Het
Pstpip1 A T 9: 56,128,650 D393V probably damaging Het
Rab5b A G 10: 128,683,193 probably null Het
Rap1gap2 G A 11: 74,393,119 R618C probably damaging Het
Rin1 A G 19: 5,050,773 probably benign Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sdk1 A G 5: 142,081,716 T1124A probably damaging Het
Sirpb1c T A 3: 15,838,777 T88S possibly damaging Het
Slc35f6 T A 5: 30,656,777 I189N probably damaging Het
Spsb2 A T 6: 124,810,281 Q226L probably benign Het
Stab2 T C 10: 86,905,592 D1221G possibly damaging Het
Sugp1 G A 8: 70,070,150 R500H probably benign Het
Syne1 A G 10: 5,132,078 Y849H probably damaging Het
Tbck T A 3: 132,722,331 I249N possibly damaging Het
Tdrd6 A C 17: 43,624,204 F1984L probably benign Het
Tnxb T A 17: 34,671,340 V219E unknown Het
Tpst1 T A 5: 130,114,503 V294D probably damaging Het
Treml1 A G 17: 48,360,219 Q44R probably damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Vars2 A G 17: 35,658,250 L853P probably damaging Het
Vmn1r10 A T 6: 57,113,630 N69I possibly damaging Het
Vmn1r179 T A 7: 23,928,394 Y3* probably null Het
Vmn2r38 T A 7: 9,090,729 Y498F probably benign Het
Zc3h11a T C 1: 133,638,917 T179A probably damaging Het
Zmym2 A G 14: 56,902,712 T3A probably benign Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62635962 missense probably damaging 1.00
IGL00642:Arap2 APN 5 62733058 nonsense probably null
IGL00705:Arap2 APN 5 62678023 missense probably damaging 1.00
IGL00942:Arap2 APN 5 62698389 nonsense probably null
IGL01069:Arap2 APN 5 62649856 missense probably benign
IGL01601:Arap2 APN 5 62641342 missense probably damaging 1.00
IGL01986:Arap2 APN 5 62621922 missense probably damaging 1.00
IGL02032:Arap2 APN 5 62670997 missense probably damaging 0.99
IGL02262:Arap2 APN 5 62642841 missense probably damaging 1.00
IGL02331:Arap2 APN 5 62649682 splice site probably benign
IGL02527:Arap2 APN 5 62749307 missense probably benign
IGL02803:Arap2 APN 5 62749109 missense probably benign
IGL02864:Arap2 APN 5 62677965 missense probably damaging 1.00
IGL03078:Arap2 APN 5 62733065 splice site probably benign
IGL03154:Arap2 APN 5 62642925 missense probably damaging 1.00
IGL03213:Arap2 APN 5 62749095 missense probably benign 0.00
IGL03279:Arap2 APN 5 62621910 missense probably damaging 1.00
IGL03288:Arap2 APN 5 62604616 missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R0012:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0166:Arap2 UTSW 5 62676018 missense probably damaging 1.00
R0472:Arap2 UTSW 5 62706659 missense probably damaging 1.00
R0506:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62641323 splice site probably null
R0607:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62649907 splice site probably benign
R0975:Arap2 UTSW 5 62730886 splice site probably benign
R0976:Arap2 UTSW 5 62649884 missense probably damaging 1.00
R1164:Arap2 UTSW 5 62683477 missense probably damaging 1.00
R1268:Arap2 UTSW 5 62730621 missense probably benign 0.00
R1480:Arap2 UTSW 5 62669129 nonsense probably null
R1502:Arap2 UTSW 5 62604404 missense probably benign 0.00
R1543:Arap2 UTSW 5 62606155 nonsense probably null
R1865:Arap2 UTSW 5 62698263 missense probably damaging 0.97
R1962:Arap2 UTSW 5 62676664 missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62748916 missense probably damaging 0.99
R2118:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2131:Arap2 UTSW 5 62677958 missense probably damaging 1.00
R2201:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2215:Arap2 UTSW 5 62677176 missense probably damaging 1.00
R3027:Arap2 UTSW 5 62669897 missense probably damaging 1.00
R3053:Arap2 UTSW 5 62748857 missense probably benign 0.35
R3975:Arap2 UTSW 5 62748894 missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62749170 missense probably benign 0.06
R4659:Arap2 UTSW 5 62654126 missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62669969 missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62749094 missense probably benign 0.43
R4808:Arap2 UTSW 5 62730641 missense probably benign 0.23
R4941:Arap2 UTSW 5 62749478 missense probably benign 0.20
R4983:Arap2 UTSW 5 62676525 missense probably damaging 0.98
R5095:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R5156:Arap2 UTSW 5 62669181 nonsense probably null
R5201:Arap2 UTSW 5 62683489 missense probably damaging 1.00
R5346:Arap2 UTSW 5 62714746 missense probably benign 0.39
R5359:Arap2 UTSW 5 62683419 nonsense probably null
R5426:Arap2 UTSW 5 62642816 missense probably benign 0.02
R5503:Arap2 UTSW 5 62630186 missense probably damaging 1.00
R5605:Arap2 UTSW 5 62615067 missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62642854 missense probably damaging 1.00
R5813:Arap2 UTSW 5 62677163 missense probably damaging 1.00
R5846:Arap2 UTSW 5 62649773 missense probably damaging 1.00
R6084:Arap2 UTSW 5 62670954 missense possibly damaging 0.89
R6173:Arap2 UTSW 5 62749622 missense probably damaging 1.00
R6175:Arap2 UTSW 5 62714731 critical splice donor site probably null
R6249:Arap2 UTSW 5 62646193 missense probably damaging 0.99
R6386:Arap2 UTSW 5 62604522 missense possibly damaging 0.89
R6424:Arap2 UTSW 5 62683364 missense probably damaging 1.00
R6744:Arap2 UTSW 5 62748938 missense probably damaging 1.00
R6766:Arap2 UTSW 5 62677100 critical splice donor site probably null
R6990:Arap2 UTSW 5 62676517 missense probably damaging 0.96
R7067:Arap2 UTSW 5 62654044 critical splice donor site probably null
R7098:Arap2 UTSW 5 62675950 critical splice donor site probably null
R7156:Arap2 UTSW 5 62604571 missense probably damaging 1.00
R7174:Arap2 UTSW 5 62604278 missense probably benign
R7187:Arap2 UTSW 5 62669053 missense probably damaging 0.99
R7197:Arap2 UTSW 5 62641386 missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62749338 missense probably benign 0.00
R7317:Arap2 UTSW 5 62649724 missense probably damaging 1.00
R7392:Arap2 UTSW 5 62698385 missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62749475 missense probably damaging 0.99
R7452:Arap2 UTSW 5 62676549 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTTGCTAGGCACCAGAAGC -3'
(R):5'- GAGACCTCAAAGCTCAGTTCAC -3'

Sequencing Primer
(F):5'- GTAATTAATACACCCAGCCATGTG -3'
(R):5'- ACTTAAGTGTTTCACATCCCGGAG -3'
Posted On2019-05-15