Mutagenetix > Incidental Mutation

Incidental Mutation 'R0597:Slfn10-ps'

55133

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

038786-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R0597 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82919681-82926992 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 82926479 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Coding Region Coverage

1x: 99.6%
3x: 99.0%
10x: 97.4%
20x: 94.1%

Validation Efficiency

97% (71/73)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	T	C	1: 165,352,631 (GRCm39)		probably null	Het
Anxa11	T	C	14: 25,874,652 (GRCm39)	I221T	probably damaging	Het
Arhgap33	C	G	7: 30,225,871 (GRCm39)	R565P	probably damaging	Het
Bmpr2	T	C	1: 59,880,584 (GRCm39)		probably benign	Het
Btn2a2	T	A	13: 23,670,580 (GRCm39)	H51L	probably benign	Het
Casz1	T	C	4: 149,028,851 (GRCm39)	S1099P	probably benign	Het
Cnot4	A	G	6: 35,028,438 (GRCm39)	S393P	possibly damaging	Het
Cntnap5a	T	C	1: 116,112,191 (GRCm39)		probably benign	Het
Cobl	T	C	11: 12,204,699 (GRCm39)	T586A	probably benign	Het
Crocc	T	C	4: 140,747,224 (GRCm39)	K1528R	probably benign	Het
Crocc	A	G	4: 140,744,382 (GRCm39)	L1838P	probably benign	Het
Dact2	A	G	17: 14,417,303 (GRCm39)	V299A	probably benign	Het
Dapk1	C	A	13: 60,909,198 (GRCm39)	N1270K	probably benign	Het
Ddx41	T	C	13: 55,680,819 (GRCm39)	Y375C	probably damaging	Het
Dock5	T	A	14: 68,022,383 (GRCm39)		probably null	Het
Dyrk4	T	G	6: 126,863,612 (GRCm39)		probably null	Het
Eno1b	T	C	18: 48,180,806 (GRCm39)	I328T	probably benign	Het
Fam210b	A	G	2: 172,187,773 (GRCm39)		probably benign	Het
Fbxl13	A	G	5: 21,819,712 (GRCm39)	I229T	probably benign	Het
Fbxo39	A	G	11: 72,207,747 (GRCm39)	D33G	probably damaging	Het
Fbxw11	A	G	11: 32,670,496 (GRCm39)	E120G	probably damaging	Het
Fbxw2	A	T	2: 34,701,032 (GRCm39)	L261Q	probably damaging	Het
Gm5800	A	C	14: 51,953,461 (GRCm39)	N51K	probably benign	Het
Gm6899	A	G	11: 26,543,768 (GRCm39)		probably benign	Het
Gpx8	T	C	13: 113,182,035 (GRCm39)	T133A	possibly damaging	Het
Grin3a	C	T	4: 49,665,351 (GRCm39)	V1095M	probably damaging	Het
Grip2	T	C	6: 91,773,178 (GRCm39)		probably benign	Het
Hacd4	A	G	4: 88,355,757 (GRCm39)	F43L	probably damaging	Het
Hif1a	T	G	12: 73,989,049 (GRCm39)	S645R	probably benign	Het
Hipk3	A	G	2: 104,263,982 (GRCm39)	S839P	possibly damaging	Het
Idi2l	C	A	13: 8,990,802 (GRCm39)		probably benign	Het
Il16	A	T	7: 83,327,183 (GRCm39)		probably benign	Het
Il3ra	T	A	14: 14,351,166 (GRCm38)		probably null	Het
Il5ra	A	G	6: 106,721,296 (GRCm39)	M1T	probably null	Het
Klra2	G	A	6: 131,197,148 (GRCm39)	R251C	probably benign	Het
Lamc2	C	T	1: 153,009,367 (GRCm39)	V813M	probably benign	Het
Lbr	A	G	1: 181,659,778 (GRCm39)	V139A	probably benign	Het
Lrp5	T	C	19: 3,650,777 (GRCm39)	D1219G	possibly damaging	Het
Map3k6	C	T	4: 132,972,863 (GRCm39)	P341S	possibly damaging	Het
Mcts2	A	G	2: 152,529,609 (GRCm39)	E140G	probably benign	Het
Med1	T	C	11: 98,060,264 (GRCm39)	M222V	probably benign	Het
Mef2a	G	T	7: 66,884,896 (GRCm39)	S406*	probably null	Het
Muc19	A	T	15: 91,784,696 (GRCm39)		noncoding transcript	Het
Nr1h2	A	G	7: 44,201,684 (GRCm39)		probably benign	Het
Or13j1	A	T	4: 43,706,592 (GRCm39)		probably null	Het
Or2w6	C	A	13: 21,843,316 (GRCm39)	R59L	probably damaging	Het
Or56a42-ps1	A	G	7: 104,777,425 (GRCm39)	V73A	possibly damaging	Het
Or5ac23	A	T	16: 59,149,123 (GRCm39)	F250I	probably damaging	Het
P4hb	G	A	11: 120,459,070 (GRCm39)	T141I	possibly damaging	Het
Polr3a	A	G	14: 24,534,202 (GRCm39)	V101A	probably benign	Het
Pou4f2	A	G	8: 79,161,869 (GRCm39)	S245P	probably benign	Het
Pramel26	G	T	4: 143,539,222 (GRCm39)	N90K	probably damaging	Het
Rnpep	A	G	1: 135,200,157 (GRCm39)	V266A	probably damaging	Het
Scly	G	A	1: 91,237,555 (GRCm39)	G206R	probably damaging	Het
Sec14l3	A	T	11: 4,024,814 (GRCm39)	K254N	probably damaging	Het
Sgpp1	A	T	12: 75,781,874 (GRCm39)	I155N	probably damaging	Het
Slc22a14	A	G	9: 119,001,190 (GRCm39)	L468P	probably damaging	Het
Slc22a27	A	G	19: 7,843,249 (GRCm39)	F377L	probably benign	Het
Slc44a3	T	C	3: 121,253,719 (GRCm39)	I625V	probably benign	Het
Slc47a2	A	T	11: 61,200,802 (GRCm39)	I373N	probably damaging	Het
Smarcd1	T	A	15: 99,608,975 (GRCm39)	I383N	probably damaging	Het
Sort1	A	G	3: 108,246,226 (GRCm39)	D401G	probably damaging	Het
Sprr2a3	G	T	3: 92,195,897 (GRCm39)	M1I	probably null	Het
Sycp2	A	C	2: 177,998,373 (GRCm39)	V1049G	possibly damaging	Het
Tecrl	T	A	5: 83,502,775 (GRCm39)	K10*	probably null	Het
Tnpo3	A	T	6: 29,578,564 (GRCm39)	C303*	probably null	Het
Vmn2r23	A	G	6: 123,706,680 (GRCm39)	I503M	probably benign	Het
Zbtb8os	T	A	4: 129,240,670 (GRCm39)	I164N	probably damaging	Het
Zfp292	T	C	4: 34,807,399 (GRCm39)	N1882D	probably benign	Het
Zfp91	T	C	19: 12,747,459 (GRCm39)	I555V	possibly damaging	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	82,926,085 (GRCm39)	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	82,926,353 (GRCm39)	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	82,926,322 (GRCm39)	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	82,926,761 (GRCm39)	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	82,919,938 (GRCm39)	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	82,923,016 (GRCm39)	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	82,919,890 (GRCm39)	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	82,923,117 (GRCm39)	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	82,921,090 (GRCm39)	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	82,920,971 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	82,926,128 (GRCm39)	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	82,926,600 (GRCm39)	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	82,920,360 (GRCm39)	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	82,926,388 (GRCm39)	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	82,926,235 (GRCm39)	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	82,920,676 (GRCm39)	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	82,920,869 (GRCm39)	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	82,921,168 (GRCm39)	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	82,926,511 (GRCm39)	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	82,919,756 (GRCm39)	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	82,919,955 (GRCm39)	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	82,926,260 (GRCm39)	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	82,920,345 (GRCm39)	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	82,921,207 (GRCm39)	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	82,921,341 (GRCm39)	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	82,919,851 (GRCm39)	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
R5444:Slfn10-ps	UTSW	11	82,926,113 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGCCACAGTTTTCAAAGAGTCACGG -3'
(R):5'- CCCTGAAGATGCTTCCACTAAGCC -3'

Sequencing Primer
(F):5'- TTTCAAAGAGTCACGGTCAACG -3'
(R):5'- TGCCATGGATTCAAGGGAAG -3'

Posted On

2013-07-11