Incidental Mutation 'R7108:Cyth1'
ID551349
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Namecytohesin 1
SynonymsCTH-1, Pscd1, CLM1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7108 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location118132019-118248592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118182913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 198 (D198G)
Ref Sequence ENSEMBL: ENSMUSP00000097756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
Predicted Effect probably benign
Transcript: ENSMUST00000017276
AA Change: D184G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: D184G

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100181
AA Change: D198G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: D198G

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106302
AA Change: D186G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: D186G

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106305
AA Change: D184G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: D184G

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151165
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
4930503L19Rik A T 18: 70,468,476 Y112N probably benign Het
Abcd2 A T 15: 91,191,274 V112E probably benign Het
Acadm A T 3: 153,925,800 Y353* probably null Het
Adra2c A G 5: 35,279,998 D38G probably benign Het
Ankrd10 C T 8: 11,612,624 G370R probably damaging Het
Arfgef2 T A 2: 166,873,608 N1324K possibly damaging Het
Atp6v1b2 A G 8: 69,102,501 T172A probably damaging Het
BC003331 T C 1: 150,382,290 Y198C probably benign Het
Bloc1s1 T A 10: 128,922,723 K22M possibly damaging Het
Brpf3 A G 17: 28,817,125 T599A probably benign Het
Cacna1e TTCCAGTCTC TTC 1: 154,468,995 probably null Het
Casc1 G A 6: 145,185,865 Q351* probably null Het
Ccdc186 T C 19: 56,798,760 D592G probably damaging Het
Cfap161 A T 7: 83,793,310 D98E possibly damaging Het
Cfi G A 3: 129,875,016 V564M probably damaging Het
Cilp2 T A 8: 69,881,129 Q1073L probably damaging Het
Cox6b1 A G 7: 30,623,504 C40R possibly damaging Het
Cyp3a59 A T 5: 146,096,333 M172L probably benign Het
Daam2 T C 17: 49,460,674 D963G probably damaging Het
Ddi2 A T 4: 141,705,937 D209E probably benign Het
Dnah12 G A 14: 26,778,912 probably null Het
Dpagt1 G T 9: 44,327,021 probably benign Het
Drc3 T A 11: 60,370,554 F177Y probably benign Het
Dsg2 T C 18: 20,601,863 V966A probably damaging Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
E4f1 A G 17: 24,444,578 V633A probably damaging Het
Eif2ak2 T A 17: 78,858,536 R411* probably null Het
Frem2 T C 3: 53,653,513 E1191G probably damaging Het
Fry T C 5: 150,395,786 V972A probably damaging Het
Fry T A 5: 150,491,090 C467S Het
Fscn1 T C 5: 142,960,515 Y23H probably damaging Het
Gm16506 T A 14: 43,724,302 I163F Het
Gm21103 T C 14: 6,303,774 Y92C probably damaging Het
Golgb1 A G 16: 36,913,721 H1151R probably benign Het
Gprc5c T C 11: 114,864,282 Y262H probably damaging Het
Hc G T 2: 35,039,694 N245K probably benign Het
Hps6 T A 19: 46,005,490 L622Q probably damaging Het
Hsd17b1 T C 11: 101,079,209 Y156H probably damaging Het
Ireb2 T A 9: 54,906,641 F799L probably damaging Het
Irf1 A G 11: 53,774,412 D205G probably damaging Het
Kif12 A T 4: 63,171,205 F103L probably benign Het
Krt12 C T 11: 99,416,052 V475M unknown Het
Lca5 T A 9: 83,423,169 T195S probably benign Het
Lrrc17 T C 5: 21,575,339 V437A possibly damaging Het
Malt1 G T 18: 65,464,051 D468Y probably damaging Het
Man2b2 C T 5: 36,815,485 A562T probably benign Het
Mrc1 C T 2: 14,304,146 Q794* probably null Het
Muc16 T A 9: 18,655,233 I1997L unknown Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Mycbp2 A T 14: 103,122,603 F4518Y probably damaging Het
Myo5a T A 9: 75,129,992 I159N probably damaging Het
Nat1 T C 8: 67,491,020 V19A probably benign Het
Ndst4 A G 3: 125,561,471 T343A probably damaging Het
Nlrp9b A T 7: 20,045,930 L839F probably damaging Het
Nxnl1 A G 8: 71,566,554 I9T probably benign Het
Olfr1351 C A 10: 79,017,649 S109* probably null Het
Olfr331 T A 11: 58,502,554 M7L probably benign Het
Olfr364-ps1 C T 2: 37,146,260 T16I probably benign Het
Olfr548-ps1 A T 7: 102,541,992 I19F probably damaging Het
Olfr693 G A 7: 106,678,048 A146V probably benign Het
Pou5f2 T C 13: 78,025,265 S109P possibly damaging Het
Prkcz G A 4: 155,286,793 Q321* probably null Het
Prr18 G T 17: 8,341,531 R173L probably damaging Het
Ralgapb T C 2: 158,492,460 Y1364H probably damaging Het
Ralgapb A T 2: 158,494,662 I1407F probably damaging Het
Sacs T A 14: 61,211,009 Y3501* probably null Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Scn8a A T 15: 101,039,778 H1676L probably benign Het
Shmt1 T C 11: 60,798,644 D178G probably damaging Het
Slmap T C 14: 26,422,521 K737R probably benign Het
Ssh2 G A 11: 77,454,794 V1202I probably benign Het
Stard7 A G 2: 127,295,494 D288G possibly damaging Het
Tek A T 4: 94,853,487 D827V probably damaging Het
Tfap2e A G 4: 126,720,563 L276P probably damaging Het
Tns3 T C 11: 8,437,251 N1312S probably benign Het
Tubd1 T A 11: 86,557,805 S315T probably damaging Het
Ube2f T A 1: 91,265,219 C50* probably null Het
Vmn2r109 T C 17: 20,564,744 I5V probably benign Het
Vmn2r39 T C 7: 9,023,668 T445A probably damaging Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118193613 critical splice donor site probably null
IGL02047:Cyth1 APN 11 118169132 missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118182246 missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118185481 missense possibly damaging 0.89
Mucilage UTSW 11 118170860 missense probably damaging 1.00
Stuck UTSW 11 118185759 critical splice donor site probably null
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118132248 unclassified probably benign
R1387:Cyth1 UTSW 11 118182346 unclassified probably benign
R1599:Cyth1 UTSW 11 118177221 missense probably damaging 0.99
R2098:Cyth1 UTSW 11 118193653 missense probably damaging 1.00
R2156:Cyth1 UTSW 11 118182808 missense probably damaging 1.00
R3546:Cyth1 UTSW 11 118192436 missense probably damaging 0.96
R4300:Cyth1 UTSW 11 118183894 missense probably damaging 0.98
R4589:Cyth1 UTSW 11 118184985 missense possibly damaging 0.70
R4799:Cyth1 UTSW 11 118183942 missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118169082 missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118182767 missense probably benign 0.27
R5834:Cyth1 UTSW 11 118192463 critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118185759 critical splice donor site probably null
R5960:Cyth1 UTSW 11 118132367 unclassified probably benign
R6609:Cyth1 UTSW 11 118170860 missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118212651 missense probably benign
R7237:Cyth1 UTSW 11 118185495 missense probably damaging 1.00
X0063:Cyth1 UTSW 11 118132329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGACATGAAGTGGCTCTGG -3'
(R):5'- ACATATGCTCGGGTGATAGTGC -3'

Sequencing Primer
(F):5'- GCTCTGGCCCTGCTCAC -3'
(R):5'- TATGGAGGCTAACGTCATGCTCC -3'
Posted On2019-05-15