Incidental Mutation 'R7109:Ppp1r3a'
ID551386
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3A
SynonymsRGL, GM
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7109 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location14713977-14755274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14719236 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 560 (W560R)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: W560R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: W560R

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T G 2: 151,473,753 K2Q probably damaging Het
Abtb2 T C 2: 103,715,515 Y903H probably benign Het
Adamtsl3 C T 7: 82,611,861 P29S Het
Alcam T A 16: 52,276,829 T355S probably damaging Het
Anapc1 A G 2: 128,674,602 V404A probably benign Het
Bst2 A G 8: 71,537,282 F49S possibly damaging Het
C1qtnf9 G C 14: 60,779,570 W183S probably benign Het
Camsap3 A G 8: 3,598,087 I132V possibly damaging Het
Cchcr1 T A 17: 35,517,941 probably null Het
Cenpk A G 13: 104,230,748 K31E probably benign Het
Cfap221 T C 1: 119,925,571 K798E possibly damaging Het
Copb2 T A 9: 98,581,280 probably null Het
Dennd1a T A 2: 38,048,792 Y102F probably damaging Het
Eif2ak4 C T 2: 118,405,051 P88S probably damaging Het
Epha6 C A 16: 59,682,668 V959F probably damaging Het
Fam193a C A 5: 34,465,821 T1251K possibly damaging Het
Herc1 A T 9: 66,481,889 Q3896L probably benign Het
Ikbip C A 10: 91,083,228 D34E probably benign Het
Insr A G 8: 3,258,481 V185A probably benign Het
Jakmip1 C T 5: 37,174,765 Q930* probably null Het
Klc1 A G 12: 111,776,865 I209V probably benign Het
Lrrk2 T A 15: 91,764,782 L1660M probably damaging Het
Mbd3l1 G T 9: 18,484,914 D112Y possibly damaging Het
Mrps2 T A 2: 28,468,246 V16E probably benign Het
Ncoa1 G A 12: 4,322,978 T141I possibly damaging Het
Ndst2 G T 14: 20,729,843 R110S probably damaging Het
Nlrp2 A G 7: 5,328,617 V260A probably damaging Het
Olfr1425 A G 19: 12,074,212 I140T probably benign Het
Olfr491 A G 7: 108,317,752 N286S probably damaging Het
Olfr575 A T 7: 102,955,253 V116E probably damaging Het
Olfr828 A T 9: 18,815,608 S229T probably benign Het
Pah T C 10: 87,570,286 V262A probably damaging Het
Pcnt T G 10: 76,369,904 E2538A probably damaging Het
Pdxk T A 10: 78,446,976 I162F probably damaging Het
Plod2 T C 9: 92,573,597 F110L probably damaging Het
Pm20d2 A T 4: 33,187,186 L154Q probably damaging Het
Podxl2 C T 6: 88,843,584 V445I possibly damaging Het
Rasal3 A G 17: 32,392,709 S815P probably damaging Het
Rdm1 A G 11: 101,633,828 K196E probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Scn1a T C 2: 66,350,942 D79G possibly damaging Het
Slc22a21 A G 11: 53,979,503 Y119H possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Synrg C A 11: 84,039,672 A1280E possibly damaging Het
Szt2 A G 4: 118,375,479 C2396R unknown Het
Trappc3 A G 4: 126,273,933 N95S probably benign Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Ush2a T A 1: 188,381,484 D633E probably benign Het
Wasl G A 6: 24,633,187 P151S probably benign Het
Wwp2 A G 8: 107,483,356 N122S probably benign Het
Zfp51 A G 17: 21,463,569 R149G possibly damaging Het
Zfp764 A G 7: 127,404,715 S415P possibly damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14755084 missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14719060 missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14718408 missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14717852 missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14718609 missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14718346 missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14754811 missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14717715 missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14718600 missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14718459 missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14719762 missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14719811 missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14722065 splice site probably benign
IGL03290:Ppp1r3a APN 6 14754772 missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14719766 missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14719697 missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14717777 missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14717661 missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14754517 missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14718960 missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14719697 missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14754718 missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14717982 missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14754994 missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14722104 missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14721875 missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14718323 missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14719378 missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14719414 missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14719912 missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14719781 missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14754682 missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14718993 missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14719047 missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14754681 missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14719604 missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14719418 missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14719349 missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14719763 missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14719883 missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14718984 missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14718989 missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14719340 missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14754604 missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14718431 missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14719571 missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14718981 nonsense probably null
R6869:Ppp1r3a UTSW 6 14754826 missense probably benign 0.39
R7188:Ppp1r3a UTSW 6 14719191 missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14719070 missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14718750 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATTGCTAGAGTCTGAGTTTTCCC -3'
(R):5'- GAAGAGTCAAATGCATCTTCCAGAG -3'

Sequencing Primer
(F):5'- CCCTGTCAGCTTGAAAAAGATG -3'
(R):5'- TCCAGAGATGATTATGCCAAAGTCG -3'
Posted On2019-05-15