Incidental Mutation 'R7110:Med12l'
ID551431
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R7110 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59262224 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1603 (T1603K)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040325
AA Change: T1568K

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: T1568K

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164225
AA Change: T1603K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: T1603K

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197374
AA Change: T245K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199659
AA Change: T1603K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: T1603K

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,745 T184A possibly damaging Het
Abca4 T A 3: 122,132,643 Y1243N probably damaging Het
Adamts7 A G 9: 90,193,964 T1250A possibly damaging Het
Adgrg3 T C 8: 95,034,963 V118A possibly damaging Het
Agrn A G 4: 156,178,875 V364A possibly damaging Het
Cacna2d1 C A 5: 16,357,784 L853I probably damaging Het
Ccdc25 A G 14: 65,856,716 K124R probably benign Het
Ccdc73 A G 2: 104,973,224 M236V probably benign Het
Cdh1 G A 8: 106,668,544 D862N possibly damaging Het
Cdh5 A G 8: 104,140,768 D559G probably damaging Het
Celsr2 C A 3: 108,397,865 G2133C probably damaging Het
Chd5 A G 4: 152,385,439 N1823S probably damaging Het
Cog7 T C 7: 121,935,776 N562S probably damaging Het
Dcaf6 A T 1: 165,351,968 S534R probably benign Het
Donson G A 16: 91,682,121 R436* probably null Het
Foxi3 A G 6: 70,960,746 T321A probably benign Het
Frmd4b A T 6: 97,296,231 Y733* probably null Het
Fscn2 A T 11: 120,366,754 T314S probably benign Het
Gfral A G 9: 76,164,830 I386T possibly damaging Het
Gm21698 T C 5: 25,985,177 E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm9573 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,622,618 probably benign Het
Gprin1 T C 13: 54,739,243 D406G probably benign Het
Habp2 A T 19: 56,311,164 R128* probably null Het
Hoxc10 A T 15: 102,970,921 Y292F probably damaging Het
Hydin A T 8: 110,354,951 probably null Het
Igkv12-89 T C 6: 68,835,131 D18G probably damaging Het
Jhy T C 9: 40,917,260 N450S probably damaging Het
Klhl18 T A 9: 110,450,765 Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Ly75 A G 2: 60,376,184 I47T probably benign Het
Mgat5 A G 1: 127,382,979 D210G possibly damaging Het
Mgmt G T 7: 137,085,986 G55W probably damaging Het
Mrpl57 G A 14: 57,826,297 probably benign Het
Mtg1 G A 7: 140,146,866 R209Q probably benign Het
Muc5ac T G 7: 141,799,822 C826W possibly damaging Het
Myot A G 18: 44,341,386 D146G probably damaging Het
Nlrp4f T A 13: 65,199,346 I11F probably damaging Het
Nsun5 T A 5: 135,371,250 Y76N probably damaging Het
Olfr8 A T 10: 78,955,450 M82L possibly damaging Het
Pcdhb3 A G 18: 37,302,922 N647S possibly damaging Het
Pdgfra T A 5: 75,189,234 Y926* probably null Het
Pdzd2 A T 15: 12,368,013 L2630H probably damaging Het
Phox2b G A 5: 67,096,162 S297L unknown Het
Ppp4r2 T A 6: 100,865,862 V238E probably damaging Het
Proc A T 18: 32,133,388 F129I probably benign Het
Sgca T A 11: 94,963,401 probably null Het
Slurp2 G A 15: 74,743,115 T59I probably benign Het
Son A G 16: 91,656,518 T718A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spink7 T C 18: 62,594,267 N62S probably damaging Het
Stxbp3 C A 3: 108,816,333 R195S probably damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Tbc1d9b A T 11: 50,163,830 I934F probably benign Het
Tecpr2 T G 12: 110,918,972 L195R probably damaging Het
Tns2 G C 15: 102,105,366 C71S probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp40 G T 1: 87,986,162 T403K probably benign Het
Vat1 G T 11: 101,465,713 R141S possibly damaging Het
Vmn2r28 T G 7: 5,490,734 N71T probably benign Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACTGTTGACATGCACAC -3'
(R):5'- GCTTGTAATTTTGAAGGACTGACAGAG -3'

Sequencing Primer
(F):5'- TGTTGACATGCACACTAACAAG -3'
(R):5'- AATAACCACAATCTGCTGAATCAG -3'
Posted On2019-05-15