Incidental Mutation 'R7110:Mtg1'
ID551449
Institutional Source Beutler Lab
Gene Symbol Mtg1
Ensembl Gene ENSMUSG00000039018
Gene Namemitochondrial ribosome-associated GTPase 1
SynonymsGtpbp7, LOC212508
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7110 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140137564-140150786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140146866 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 209 (R209Q)
Ref Sequence ENSEMBL: ENSMUSP00000036491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036977] [ENSMUST00000059241]
Predicted Effect probably benign
Transcript: ENSMUST00000036977
AA Change: R209Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018
AA Change: R209Q

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059241
SMART Domains Protein: ENSMUSP00000053901
Gene: ENSMUSG00000045733

DomainStartEndE-ValueType
Pfam:Shadoo 19 147 7.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156791
Predicted Effect probably benign
Transcript: ENSMUST00000211171
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A G 11: 58,425,745 T184A possibly damaging Het
Abca4 T A 3: 122,132,643 Y1243N probably damaging Het
Adamts7 A G 9: 90,193,964 T1250A possibly damaging Het
Adgrg3 T C 8: 95,034,963 V118A possibly damaging Het
Agrn A G 4: 156,178,875 V364A possibly damaging Het
Cacna2d1 C A 5: 16,357,784 L853I probably damaging Het
Ccdc25 A G 14: 65,856,716 K124R probably benign Het
Ccdc73 A G 2: 104,973,224 M236V probably benign Het
Cdh1 G A 8: 106,668,544 D862N possibly damaging Het
Cdh5 A G 8: 104,140,768 D559G probably damaging Het
Celsr2 C A 3: 108,397,865 G2133C probably damaging Het
Chd5 A G 4: 152,385,439 N1823S probably damaging Het
Cog7 T C 7: 121,935,776 N562S probably damaging Het
Dcaf6 A T 1: 165,351,968 S534R probably benign Het
Donson G A 16: 91,682,121 R436* probably null Het
Fam53c T A 18: 34,762,470 probably null Het
Foxi3 A G 6: 70,960,746 T321A probably benign Het
Frmd4b A T 6: 97,296,231 Y733* probably null Het
Fscn2 A T 11: 120,366,754 T314S probably benign Het
Gfral A G 9: 76,164,830 I386T possibly damaging Het
Gm21698 T C 5: 25,985,177 E174G probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm9573 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT 17: 35,622,618 probably benign Het
Gprin1 T C 13: 54,739,243 D406G probably benign Het
Habp2 A T 19: 56,311,164 R128* probably null Het
Hoxc10 A T 15: 102,970,921 Y292F probably damaging Het
Hydin A T 8: 110,354,951 probably null Het
Igkv12-89 T C 6: 68,835,131 D18G probably damaging Het
Jhy T C 9: 40,917,260 N450S probably damaging Het
Klhl18 T A 9: 110,450,765 Q119L probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lsmem1 A T 12: 40,185,273 probably null Het
Ly75 A G 2: 60,376,184 I47T probably benign Het
Med12l C A 3: 59,262,224 T1603K possibly damaging Het
Mgat5 A G 1: 127,382,979 D210G possibly damaging Het
Mgmt G T 7: 137,085,986 G55W probably damaging Het
Mrpl57 G A 14: 57,826,297 probably benign Het
Muc5ac T G 7: 141,799,822 C826W possibly damaging Het
Myot A G 18: 44,341,386 D146G probably damaging Het
Nlrp4f T A 13: 65,199,346 I11F probably damaging Het
Nsun5 T A 5: 135,371,250 Y76N probably damaging Het
Olfr8 A T 10: 78,955,450 M82L possibly damaging Het
Pcdhb3 A G 18: 37,302,922 N647S possibly damaging Het
Pdgfra T A 5: 75,189,234 Y926* probably null Het
Pdzd2 A T 15: 12,368,013 L2630H probably damaging Het
Phox2b G A 5: 67,096,162 S297L unknown Het
Polr3e T A 7: 120,940,287 probably null Het
Ppp4r2 T A 6: 100,865,862 V238E probably damaging Het
Proc A T 18: 32,133,388 F129I probably benign Het
Sgca T A 11: 94,963,401 probably null Het
Slc7a10 A G 7: 35,199,584 H360R probably benign Het
Slurp2 G A 15: 74,743,115 T59I probably benign Het
Son A G 16: 91,656,518 T718A probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spink7 T C 18: 62,594,267 N62S probably damaging Het
Stxbp3 C A 3: 108,816,333 R195S probably damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Tbc1d9b A T 11: 50,163,830 I934F probably benign Het
Tecpr2 T G 12: 110,918,972 L195R probably damaging Het
Tns2 G C 15: 102,105,366 C71S probably damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Usp40 G T 1: 87,986,162 T403K probably benign Het
Vat1 G T 11: 101,465,713 R141S possibly damaging Het
Vmn2r28 T G 7: 5,490,734 N71T probably benign Het
Other mutations in Mtg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Mtg1 APN 7 140150236 missense probably benign 0.00
IGL02105:Mtg1 APN 7 140150206 missense probably damaging 1.00
IGL02458:Mtg1 APN 7 140150172 missense probably benign 0.01
IGL02682:Mtg1 APN 7 140144729 splice site probably benign
R0666:Mtg1 UTSW 7 140144344 missense probably benign
R0893:Mtg1 UTSW 7 140149752 missense probably damaging 1.00
R3707:Mtg1 UTSW 7 140149804 missense probably damaging 0.99
R4993:Mtg1 UTSW 7 140140283 missense probably null 1.00
R5810:Mtg1 UTSW 7 140145985 splice site probably null
R5886:Mtg1 UTSW 7 140149865 splice site probably null
R5960:Mtg1 UTSW 7 140146993 unclassified probably benign
R7069:Mtg1 UTSW 7 140143744 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGGACCTCAGACTTGTAGTTC -3'
(R):5'- ATGCATGCTGGGAGCTAGTC -3'

Sequencing Primer
(F):5'- GGGATTCTATACCTCAGTGCAAAAGC -3'
(R):5'- GAGCTAGTCGCCCTTTCAAAACTG -3'
Posted On2019-05-15