Incidental Mutation 'R7111:Olfr1163'
ID551494
Institutional Source Beutler Lab
Gene Symbol Olfr1163
Ensembl Gene ENSMUSG00000075137
Gene Nameolfactory receptor 1163
SynonymsMOR174-8, GA_x6K02T2Q125-49563265-49562315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7111 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88069817-88071830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88070656 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 242 (T242I)
Ref Sequence ENSEMBL: ENSMUSP00000149399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099835] [ENSMUST00000215268]
Predicted Effect probably damaging
Transcript: ENSMUST00000099835
AA Change: T242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097423
Gene: ENSMUSG00000075137
AA Change: T242I

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-44 PFAM
Pfam:7tm_1 43 292 2.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215268
AA Change: T242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T G 19: 57,073,877 N384T probably benign Het
Agap3 A G 5: 24,501,398 Y843C probably damaging Het
Aldh9a1 T A 1: 167,354,452 V118E probably benign Het
Arhgef26 T A 3: 62,345,268 S414T possibly damaging Het
Armc9 T C 1: 86,159,995 Y18H probably damaging Het
Bod1l A G 5: 41,813,120 probably null Het
Casp1 A T 9: 5,299,816 E96D probably benign Het
Ccdc171 A G 4: 83,693,761 I898V probably benign Het
Cd79b T C 11: 106,314,539 I42M possibly damaging Het
Cdca7 G A 2: 72,485,231 R346H probably damaging Het
Cdh23 T A 10: 60,387,044 D1200V probably damaging Het
Cdh7 T C 1: 110,137,908 S176P Het
Cdkn1c T C 7: 143,460,589 D40G possibly damaging Het
Ckap5 G A 2: 91,607,572 R1666H probably damaging Het
Cxcl1 A G 5: 90,891,323 T5A unknown Het
Dnah2 A C 11: 69,446,753 probably null Het
Dusp27 T C 1: 166,127,154 E9G possibly damaging Het
Ephb3 A T 16: 21,218,827 K500* probably null Het
Fam13c T A 10: 70,554,506 H533Q probably benign Het
Fat4 T A 3: 39,010,533 D4879E probably damaging Het
Grk6 G T 13: 55,458,920 W511L probably damaging Het
Hivep3 G C 4: 120,095,234 S249T possibly damaging Het
Iqch T A 9: 63,512,317 Y496F possibly damaging Het
Itga2 T C 13: 114,900,530 I21V unknown Het
Itpr2 A T 6: 146,325,056 C1397S probably damaging Het
Krt86 A T 15: 101,476,617 Y297F possibly damaging Het
Limch1 G T 5: 67,025,176 probably null Het
Mfsd6 G T 1: 52,709,758 probably null Het
Mx1 A G 16: 97,455,176 V181A probably damaging Het
Nme8 G A 13: 19,675,647 R268W probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr796 T A 10: 129,607,960 I174F possibly damaging Het
Pappa2 T A 1: 158,956,526 I305F probably benign Het
Pdlim3 A G 8: 45,917,502 K232E probably damaging Het
Rcn1 T C 2: 105,389,014 E278G probably damaging Het
Ros1 T C 10: 52,181,810 D47G probably benign Het
Sema4c G A 1: 36,553,079 T229M possibly damaging Het
Serpina3j T A 12: 104,317,533 W297R probably damaging Het
Serpinb11 A G 1: 107,376,884 E193G probably benign Het
Shank2 A G 7: 144,411,552 I966V probably benign Het
Siglece T C 7: 43,659,903 D77G probably damaging Het
Sqstm1 G T 11: 50,202,591 Q327K probably benign Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Svep1 A T 4: 58,118,207 D838E possibly damaging Het
Tacc2 G A 7: 130,728,888 A191T probably benign Het
Tnfrsf18 T A 4: 156,028,711 W285R probably damaging Het
Tspan9 T C 6: 127,965,763 D167G probably null Het
Uaca C T 9: 60,871,838 T1169I probably benign Het
Umod G T 7: 119,477,146 Y132* probably null Het
Vmn2r31 A G 7: 7,396,481 F159S probably damaging Het
Vmn2r82 C T 10: 79,378,771 T196I probably benign Het
Wdr63 T C 3: 146,097,273 I54M probably damaging Het
Wrap53 A T 11: 69,562,479 W379R probably damaging Het
Zfp866 A T 8: 69,766,571 V133D probably benign Het
Other mutations in Olfr1163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr1163 APN 2 88071124 missense possibly damaging 0.56
IGL01472:Olfr1163 APN 2 88070978 missense possibly damaging 0.56
IGL02111:Olfr1163 APN 2 88071227 missense probably benign 0.22
R1274:Olfr1163 UTSW 2 88070595 missense probably damaging 1.00
R1938:Olfr1163 UTSW 2 88070956 missense probably damaging 1.00
R2012:Olfr1163 UTSW 2 88070719 missense probably benign 0.03
R3056:Olfr1163 UTSW 2 88071239 missense probably benign
R4127:Olfr1163 UTSW 2 88071235 missense probably benign 0.00
R4748:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4749:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4769:Olfr1163 UTSW 2 88070729 missense probably benign 0.25
R6647:Olfr1163 UTSW 2 88070709 missense probably benign 0.03
R7168:Olfr1163 UTSW 2 88070577 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GATGGCTCAGTGAAGTTGGAAC -3'
(R):5'- GAATATACTGCCCTCATTGTTGTC -3'

Sequencing Primer
(F):5'- GTGCTCACTAATTTCTGAAAAACCTC -3'
(R):5'- ATACTGCCCTCATTGTTGTCTCTAG -3'
Posted On2019-05-15