Incidental Mutation 'R7112:Tbr1'
ID551545
Institutional Source Beutler Lab
Gene Symbol Tbr1
Ensembl Gene ENSMUSG00000035033
Gene NameT-box brain gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7112 (G1)
Quality Score190.009
Status Not validated
Chromosome2
Chromosomal Location61802930-61814114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61811816 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 475 (D475G)
Ref Sequence ENSEMBL: ENSMUSP00000046787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048934] [ENSMUST00000102737]
Predicted Effect probably benign
Transcript: ENSMUST00000048934
AA Change: D475G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000046787
Gene: ENSMUSG00000035033
AA Change: D475G

DomainStartEndE-ValueType
low complexity region 108 122 N/A INTRINSIC
TBOX 203 398 1.6e-125 SMART
Pfam:T-box_assoc 418 679 9.6e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102737
AA Change: D212G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099798
Gene: ENSMUSG00000035033
AA Change: D212G

DomainStartEndE-ValueType
TBOX 1 135 5.05e-41 SMART
low complexity region 184 193 N/A INTRINSIC
low complexity region 306 315 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted null allele fail to feed and die on the second postnatal day displaying disrupted forebrain morphology and a hypoplastic olfactory bulb that lacks normal mitral and tufted cells and shows a striking reduction in mature olfactory bulb projection neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,783,119 A1036E Het
Baz2b A T 2: 59,962,184 H533Q possibly damaging Het
Bcl2l11 T A 2: 128,158,315 W193R probably damaging Het
Bcl2l12 C T 7: 44,996,914 G24D probably damaging Het
Cacna1b A G 2: 24,690,761 V691A probably damaging Het
Cdh8 T C 8: 99,196,352 D304G probably damaging Het
Ces3a A T 8: 105,057,962 Q525H probably damaging Het
Csmd1 C A 8: 16,101,128 C1391F probably damaging Het
Cul7 G T 17: 46,651,698 G85V probably damaging Het
Dnah8 G A 17: 30,871,392 V4623I possibly damaging Het
Dnhd1 T A 7: 105,713,985 L3918Q probably damaging Het
Exoc4 A T 6: 33,921,488 N881Y probably damaging Het
Flt1 G C 5: 147,603,569 A770G probably damaging Het
Fndc5 A G 4: 129,142,122 N184S probably benign Het
Folh1 A G 7: 86,775,637 probably null Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gba2 A G 4: 43,568,453 V671A probably benign Het
Gm7102 T G 19: 61,175,559 D146A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph2 G A 2: 163,375,784 T324M probably damaging Het
Kank4 A G 4: 98,761,521 V937A probably damaging Het
Kdm3a T A 6: 71,632,170 E24D probably benign Het
Kidins220 T A 12: 25,004,019 L464Q probably damaging Het
Loxhd1 T A 18: 77,388,514 V1159E probably damaging Het
Malrd1 A G 2: 15,925,176 N1498D unknown Het
Mrgprb5 C T 7: 48,168,907 V27I probably benign Het
Mtfr2 A G 10: 20,357,566 N294D probably damaging Het
Muc6 A T 7: 141,649,277 L498H probably damaging Het
N4bp2 A G 5: 65,790,707 T227A possibly damaging Het
Nin C T 12: 70,102,799 R12Q Het
Obscn G C 11: 59,029,325 A27G Het
Olfr284 T A 15: 98,340,540 M150L possibly damaging Het
Olfr582 G A 7: 103,041,655 D54N probably damaging Het
Olfr729 T G 14: 50,147,935 E313A probably benign Het
Olfr746 T A 14: 50,654,126 D296E probably benign Het
Olfr912 T A 9: 38,582,034 Y252* probably null Het
Polr2a A G 11: 69,735,309 S1672P unknown Het
Qprt A G 7: 127,108,189 V245A probably damaging Het
Rab11fip5 T A 6: 85,348,194 E377V probably damaging Het
Rere A G 4: 150,406,604 T71A probably benign Het
Ret A T 6: 118,197,102 L11Q possibly damaging Het
Rp1 C T 1: 4,349,018 V624I probably benign Het
Scaf8 T A 17: 3,163,029 L131H unknown Het
Scgb2a2 A G 19: 9,851,657 R58G probably benign Het
Scn11a A G 9: 119,754,809 I1580T probably damaging Het
Slco4c1 T G 1: 96,841,141 K332T probably damaging Het
Sntg1 T G 1: 8,448,065 Y368S possibly damaging Het
Stim1 A G 7: 102,408,408 T143A probably benign Het
Tcp1 A G 17: 12,917,873 D47G probably damaging Het
Tpgs2 T C 18: 25,149,137 D119G probably damaging Het
Trim40 C A 17: 36,882,642 R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 150,645,856 probably benign Het
Trpm1 A T 7: 64,235,845 N870Y probably damaging Het
Tsr3 A G 17: 25,240,471 D47G probably benign Het
Vil1 G A 1: 74,416,002 G38R probably damaging Het
Vmn2r91 A T 17: 18,105,618 Q166L possibly damaging Het
Wdr33 C T 18: 31,893,003 T919I unknown Het
Wdr36 T C 18: 32,839,451 V64A probably benign Het
Xpnpep1 T C 19: 53,010,107 I237V probably benign Het
Zfp780b A T 7: 27,963,141 I663N probably damaging Het
Zfyve9 G A 4: 108,650,322 A513V probably benign Het
Other mutations in Tbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Tbr1 APN 2 61805281 missense probably benign 0.14
IGL01309:Tbr1 APN 2 61806067 missense possibly damaging 0.92
IGL02161:Tbr1 APN 2 61805239 nonsense probably null
IGL02256:Tbr1 APN 2 61804874 missense probably damaging 0.99
IGL02336:Tbr1 APN 2 61804992 missense possibly damaging 0.93
IGL02526:Tbr1 APN 2 61811698 missense probably benign 0.00
FR4340:Tbr1 UTSW 2 61806347 intron probably benign
R0594:Tbr1 UTSW 2 61811620 missense possibly damaging 0.49
R0847:Tbr1 UTSW 2 61805029 missense probably benign 0.00
R1101:Tbr1 UTSW 2 61804739 missense probably benign 0.00
R1247:Tbr1 UTSW 2 61811618 missense possibly damaging 0.78
R1944:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
R3080:Tbr1 UTSW 2 61807291 nonsense probably null
R4110:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4111:Tbr1 UTSW 2 61811732 missense probably benign 0.18
R4440:Tbr1 UTSW 2 61804838 missense possibly damaging 0.92
R4790:Tbr1 UTSW 2 61811588 missense probably benign 0.04
R4979:Tbr1 UTSW 2 61805249 unclassified probably null
R5054:Tbr1 UTSW 2 61806002 missense possibly damaging 0.83
R5283:Tbr1 UTSW 2 61804900 missense probably benign 0.00
R5545:Tbr1 UTSW 2 61807376 missense possibly damaging 0.93
R6178:Tbr1 UTSW 2 61804815 missense possibly damaging 0.91
R6290:Tbr1 UTSW 2 61805050 missense probably benign
R6389:Tbr1 UTSW 2 61806287 start gained probably benign
R6637:Tbr1 UTSW 2 61811630 missense probably benign 0.17
R6983:Tbr1 UTSW 2 61811735 missense probably damaging 1.00
R7021:Tbr1 UTSW 2 61807344 missense probably benign 0.18
R7254:Tbr1 UTSW 2 61806042 missense probably damaging 1.00
R7291:Tbr1 UTSW 2 61812256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTAGAGGTGGCTTTCCCTCC -3'
(R):5'- TTGGCCTGCTCGTAAATCCC -3'

Sequencing Primer
(F):5'- ATCTACACGGGCTGCGACATG -3'
(R):5'- TAAATCCCCGAGTCGCTGGAG -3'
Posted On2019-05-15