Incidental Mutation 'R7112:Cdh8'
ID551572
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
Synonymscad8
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7112 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99196352 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 304 (D304G)
Ref Sequence ENSEMBL: ENSMUSP00000117326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000145601] [ENSMUST00000155527]
PDB Structure
Crystal Structure of Cadherin8 EC1 domain [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-8 EC1-3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000093249
AA Change: D304G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510
AA Change: D304G

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128860
AA Change: D304G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510
AA Change: D304G

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142129
AA Change: D304G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510
AA Change: D304G

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145601
AA Change: D304G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510
AA Change: D304G

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155527
AA Change: D304G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510
AA Change: D304G

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 G T 12: 112,783,119 A1036E Het
Baz2b A T 2: 59,962,184 H533Q possibly damaging Het
Bcl2l11 T A 2: 128,158,315 W193R probably damaging Het
Bcl2l12 C T 7: 44,996,914 G24D probably damaging Het
Cacna1b A G 2: 24,690,761 V691A probably damaging Het
Ces3a A T 8: 105,057,962 Q525H probably damaging Het
Csmd1 C A 8: 16,101,128 C1391F probably damaging Het
Cul7 G T 17: 46,651,698 G85V probably damaging Het
Dnah8 G A 17: 30,871,392 V4623I possibly damaging Het
Dnhd1 T A 7: 105,713,985 L3918Q probably damaging Het
Exoc4 A T 6: 33,921,488 N881Y probably damaging Het
Flt1 G C 5: 147,603,569 A770G probably damaging Het
Fndc5 A G 4: 129,142,122 N184S probably benign Het
Folh1 A G 7: 86,775,637 probably null Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gba2 A G 4: 43,568,453 V671A probably benign Het
Gm7102 T G 19: 61,175,559 D146A probably damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Jph2 G A 2: 163,375,784 T324M probably damaging Het
Kank4 A G 4: 98,761,521 V937A probably damaging Het
Kdm3a T A 6: 71,632,170 E24D probably benign Het
Kidins220 T A 12: 25,004,019 L464Q probably damaging Het
Loxhd1 T A 18: 77,388,514 V1159E probably damaging Het
Malrd1 A G 2: 15,925,176 N1498D unknown Het
Mrgprb5 C T 7: 48,168,907 V27I probably benign Het
Mtfr2 A G 10: 20,357,566 N294D probably damaging Het
Muc6 A T 7: 141,649,277 L498H probably damaging Het
N4bp2 A G 5: 65,790,707 T227A possibly damaging Het
Nin C T 12: 70,102,799 R12Q Het
Obscn G C 11: 59,029,325 A27G Het
Olfr284 T A 15: 98,340,540 M150L possibly damaging Het
Olfr582 G A 7: 103,041,655 D54N probably damaging Het
Olfr729 T G 14: 50,147,935 E313A probably benign Het
Olfr746 T A 14: 50,654,126 D296E probably benign Het
Olfr912 T A 9: 38,582,034 Y252* probably null Het
Polr2a A G 11: 69,735,309 S1672P unknown Het
Qprt A G 7: 127,108,189 V245A probably damaging Het
Rab11fip5 T A 6: 85,348,194 E377V probably damaging Het
Rere A G 4: 150,406,604 T71A probably benign Het
Ret A T 6: 118,197,102 L11Q possibly damaging Het
Rp1 C T 1: 4,349,018 V624I probably benign Het
Scaf8 T A 17: 3,163,029 L131H unknown Het
Scgb2a2 A G 19: 9,851,657 R58G probably benign Het
Scn11a A G 9: 119,754,809 I1580T probably damaging Het
Slco4c1 T G 1: 96,841,141 K332T probably damaging Het
Sntg1 T G 1: 8,448,065 Y368S possibly damaging Het
Stim1 A G 7: 102,408,408 T143A probably benign Het
Tbr1 A G 2: 61,811,816 D475G probably benign Het
Tcp1 A G 17: 12,917,873 D47G probably damaging Het
Tpgs2 T C 18: 25,149,137 D119G probably damaging Het
Trim40 C A 17: 36,882,642 R225M probably null Het
Tro GCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCGAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC GCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCCTCCAAAGCCACCTCCAGTATTTGGTCCTCCAAAGCCACCTCCAGTGCTTGGTCC X: 150,645,856 probably benign Het
Trpm1 A T 7: 64,235,845 N870Y probably damaging Het
Tsr3 A G 17: 25,240,471 D47G probably benign Het
Vil1 G A 1: 74,416,002 G38R probably damaging Het
Vmn2r91 A T 17: 18,105,618 Q166L possibly damaging Het
Wdr33 C T 18: 31,893,003 T919I unknown Het
Wdr36 T C 18: 32,839,451 V64A probably benign Het
Xpnpep1 T C 19: 53,010,107 I237V probably benign Het
Zfp780b A T 7: 27,963,141 I663N probably damaging Het
Zfyve9 G A 4: 108,650,322 A513V probably benign Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1717:Cdh8 UTSW 8 99030705 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99190462 splice site probably null
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4666:Cdh8 UTSW 8 99024902 missense possibly damaging 0.71
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R5686:Cdh8 UTSW 8 99033222 missense probably benign 0.00
R6311:Cdh8 UTSW 8 99400895 missense probably damaging 0.99
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
R7181:Cdh8 UTSW 8 99098925 missense probably benign
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAGGTTTCAAAAGCCATG -3'
(R):5'- CTCACCACTTCTGGGAAATATTTG -3'

Sequencing Primer
(F):5'- CAGAGGTTTCAAAAGCCATGTTTCTC -3'
(R):5'- TGGTCATATCTCTACAGACATCCAG -3'
Posted On2019-05-15