Incidental Mutation 'R7114:Hkdc1'
ID551688
Institutional Source Beutler Lab
Gene Symbol Hkdc1
Ensembl Gene ENSMUSG00000020080
Gene Namehexokinase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R7114 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location62383137-62422491 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62393843 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 685 (E685G)
Ref Sequence ENSEMBL: ENSMUSP00000020277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020277]
Predicted Effect probably damaging
Transcript: ENSMUST00000020277
AA Change: E685G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020277
Gene: ENSMUSG00000020080
AA Change: E685G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 3.3e-71 PFAM
Pfam:Hexokinase_2 225 459 5.6e-79 PFAM
Pfam:Hexokinase_1 469 665 9.5e-76 PFAM
Pfam:Hexokinase_2 670 904 5.1e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hexokinase protein family. The encoded protein is involved in glucose metabolism, and reduced expression may be associated with gestational diabetes mellitus. High expression of this gene may also be associated with poor prognosis in hepatocarcinoma. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality prior to genotyping. Mice heterozygous for a knock-out allele exhibit impaired glucose tolerance and female-specific increased in hepatic triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Other mutations in Hkdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Hkdc1 APN 10 62393789 missense probably damaging 0.99
IGL01300:Hkdc1 APN 10 62395261 splice site probably benign
IGL01415:Hkdc1 APN 10 62393859 missense probably damaging 1.00
IGL01935:Hkdc1 APN 10 62400386 missense probably damaging 0.97
IGL02903:Hkdc1 APN 10 62400191 critical splice donor site probably null
IGL03100:Hkdc1 APN 10 62417829 missense probably benign 0.00
IGL03154:Hkdc1 APN 10 62385705 missense probably damaging 1.00
R0368:Hkdc1 UTSW 10 62411707 missense probably null 0.04
R0549:Hkdc1 UTSW 10 62400240 missense probably benign
R0667:Hkdc1 UTSW 10 62411865 splice site probably benign
R0751:Hkdc1 UTSW 10 62398673 missense probably damaging 0.99
R1779:Hkdc1 UTSW 10 62391383 missense probably damaging 1.00
R1929:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R2271:Hkdc1 UTSW 10 62417898 missense probably benign 0.01
R3831:Hkdc1 UTSW 10 62400212 missense probably benign
R4480:Hkdc1 UTSW 10 62391372 missense probably benign
R4561:Hkdc1 UTSW 10 62409839 missense probably benign 0.00
R4576:Hkdc1 UTSW 10 62385843 missense possibly damaging 0.56
R4655:Hkdc1 UTSW 10 62400463 missense probably benign 0.09
R4723:Hkdc1 UTSW 10 62400354 missense probably benign 0.00
R4810:Hkdc1 UTSW 10 62411525 missense probably benign 0.08
R5086:Hkdc1 UTSW 10 62395274 intron probably benign
R5138:Hkdc1 UTSW 10 62398691 missense probably damaging 1.00
R5781:Hkdc1 UTSW 10 62417933 missense probably damaging 0.98
R5900:Hkdc1 UTSW 10 62408666 missense possibly damaging 0.91
R5982:Hkdc1 UTSW 10 62393810 missense probably benign
R6418:Hkdc1 UTSW 10 62383804 missense possibly damaging 0.93
R6463:Hkdc1 UTSW 10 62393702 missense probably damaging 1.00
R6612:Hkdc1 UTSW 10 62395441 missense possibly damaging 0.48
R6673:Hkdc1 UTSW 10 62403606 missense probably damaging 0.99
R6761:Hkdc1 UTSW 10 62408698 missense possibly damaging 0.93
R6915:Hkdc1 UTSW 10 62401932 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCCAGAATCACATTTACATGCTCTC -3'
(R):5'- ATAGGGCACTTGTTCAAGACC -3'

Sequencing Primer
(F):5'- ACATGCTCTCTTCACACACG -3'
(R):5'- ACTTGTTCAAGACCGGCCAG -3'
Posted On2019-05-15